Skip to main content

Table 5 SNP primers and FuI vs CdS polymorphic sites.

From: SNPs and Hox gene mapping in Ciona intestinalis

Primer Sequence (5' to 3') Fu vsCdS SNP
5SNP114 (GACA)2GATGTTTATGACGAAGAA A – C
5SNP158 GACACGAGTTGTTTGGGTAATGG G – A
5SNP328 CAGATATTGGACCAAAAGTTCC T – A
10SNP108 (GACA)3TTATAATATATCTCTTGT A – T
10SNP161 CAGATTTTATTTTTGTGAATTA G – A
10SNP279 GACACAAATACTTGATTAAGTA A – G