Skip to main content

Table 2 DNA sequencing verification of false negative (Fn) and false positive (Fp) calls

From: Detection of genome-wide polymorphisms in the AT-rich Plasmodium falciparum genome using a high-density microarray

Gene ID Chr position Mism alle SFPn 3D7 7G8 Forward (5'-3') Reversed (5'-3')
MAL2.808 chr2: 306218 T/A Fn(0/5) A A tcagtagtatcttttgtttc atgtaaaactaccatcaaatg
PFC0210c chr3: 218122 G/G Fp(4/0) C C agatgtgttctttatctaatt aaccaagtgataagcacata
PFC0235w chr3: 248155 A/G Fn(0/2) A A ggaaatgtatttgagaaaaac caatgtttactatccgaatt
PFC0770c chr3: 718081 T/T Fp(4/0) T A atggggagcaaagaatttc tattccatgatgtattatgat
PFC1065w chr3: 995530 C/G Fn(1/8) G G ggaaaaagaagaagatttaa aatatatcttccgaatcatc
PFC1065w chr3: 995640 A/G Fn(0/8) A A atagatgtatcgtgtgataa attattacttctgtctctag
PFE1390w chr5: 1154254 A/A Fp(3/0) T T cgaaaaagagaagaaaaact tgtgttggcttcttaatatt
MAL6P1.232 chr6: 817214 T/A Fn(0/4) T T tccaaatcttctcaaagct ggtttattcaaaacattagg
MAL7.743 chr7: 181822 C/C Fp(5/0) C G tttaatgcttccctttgctt ataattgtgatgaagtgatg
MAL7P1.30 chr7: 512599 T/T Fp(1/0) A A atggtagaataattcatatgt ttatcacacatggtttcaac
MAL7P1.65 chr7: 519234 T/C Fn(0/2) T C aaaacaaccgtctgatataa taaacaataaatccaactgt
MAL7.2803 chr7: 621749 G/A Fn(0/6) G G ttttcgctcggattattaaa gcaacatgatttttttttttc
MAL7P1.67 chr7: 677205 C/A Fn(0/2) G T atttaacttactggattggt aatggacaaccaggttaaaa
MAL7P1.82 chr7: 794419 A/C Fn(0/7) A A gtgtacttcattttgtagtta atatctacaaaaggggaatt
MAL7P1.82 chr7: 794421 C/A Fn(0/7) A A ccatgtgctttcatatatat ccatgtaccagctcatac
PF07_0102 chr7: 922368 C/A Fn(0/4) C C aagagtattaataattccgtc gaacagaggatgaattattt
MAL8P1.42 chr8: 1017925 T/A Fn(0/1) T A tccatgatatattcccaag tattcctcatttcagggtat
MAL8.3159 chr8: 1057901 C/A Fn(0/3) C C gtacagctagttgtagtg gagctttcttactaaagtat
PF08_0017 chr8: 1179041 C/T Fn(0/1) C T cggtgataataataaatacg gaatttatagaactttccgc
PF08_0017 chr8: 169329 T/C Fn(0/1) T T ccgtctacacaataattcttt gggtagtaaatatgaggaaa
MAL8.2086 chr8: 582828 T/C Fn(0/4) T T tgggataaacctatgtataa tcattcaaatttacaggtcg
PFI1300c chr9: 1080645 T/T Fp(1/0) A A tatgatgacaatcatattcc ccttctatgaatagagatac
PFI1300c chr9: 1080729 G/A Fn(0/2) T C tacccatatcttgatttacg ctttggagatttgtttagat
PFI0495w chr9: 464714 G/G Fp(5/0) G A attctcccaaaactgaaata atatcttcgttagttatgtg
MAL9.1104 chr9: 548591 A/G Fn(0/1) A G tcttcttttcctttctacat ttaaggttccttctgaatta
PFI0690c chr9: 603205 T/A Fn(0/2) T T cgaaaaaatcctttacctt aaagatttccccctactaaa
MAL5.878 chr9: 926274 G/A Fn(0/1) C C gttcgtcttttttttcatatg Gaatataagacagatgttcc
PF10_0314 chr10: 1294935 C/G Fn(3/17) T T caatgtgaggaatatttatag ggcctcattgtggttatta
MAL10.3336 chr10: 1334877 A/A Fp(1/0) A A tttaaacacccctcaaaaaa aaatatcaaaaccggaaatg
MAL10.4084 chr10: 1433239 G/A Fn(0/1) C C aagaaataattggttgggct ttctgtccaccatttttttg
PF10_0377 chr10: 1554669 T/A Fn(9/11) T A taaaacctgtataaccaaata tatacaaactttacaaaactc
PF10_0094 chr10: 389999 A/C Fn(0/2) T T aaggtataccaatagatttg gtaaatcattcaccctcat
PF10_0138 chr10: 556132 C/C Fp(2/1) C C taatgtgtatgtatcagcta ggattgtaataagtatatgg
MAL10.1222 chr10: 564556 T/T Fp(1/0) T T gttttatgcttaggcttata tgggaaaatataaatgaagg
PF11_0338 chr11: 1272493 A/A Fp(1/0) A A gaatgttaacatacaaatgta cttcagggagaatatttattc
MAL11.3013 chr11: 1294419 T/T Fp(3/0) T T tcatggttcaggtataaga ccattattttcttgagctgc
PF11_0353 chr11: 1327608 G/A Fn(0/5) G G ttataccatatgtgtacaaag gaaatatcaaaatttcctaac
PF11_0360 chr11: 1369690 A/G Fn(0/3) A A cctattctattcaatactgt ctgtatacatttgtttggat
PF11_0046 chr11: 151916 A/G Fn(0/2) A A acaagcatagatatcatagc ataacatgtcctaaaggtga
PF11_0441 chr11: 1717528 T/A Fn(5/15) A T cagttatatacctttatcag ataagaaaaaatatccacac
MAL12.4052 chr12: 1192527 T/G Fn(1/2) T G ggatattcacaatggatttt catgtgtatcatttatacatg
MAL12.2128 chr12: 577914 T/T Fp(1/0) T T ctgatgaaagaatacatattg tgaacaatatattcggaaac
MAL12.3146 chr12: 817466 T/T Fp(1/0) T TAT aatctaaaaaatccaagtatg cataatgattgtatatccttt
PF13_0184 chr13: 1376386 T/C Fn(1/9) T T tattcttgaattttcgctac tatattttatggatcatctc
MAL13.4760 chr13: 2159993 C/T Fn(0/2) C C cacaaaagtatacgtctat ttaacagtttaggacacata
MAL13.670 chr13: 304167 C/A Fn(0/1) A A attaaataattcttcttccag catgtcttgtatttcgtttt
MAL13P1.67 chr13: 557320 A/T Fn(0/3) A A gttcttctaacacaaataaa tctacaggtaatatgttatc
PF13_0088 chr13: 650502 T/C Fn(0/4) G G cggcatgctcctgaagtaaa ttatgttagagatgggtata
PF13_0125 chr13: 912350 T/G Fn(2/3) A G catagtactatcacctgaa ctatggttataaccaagaaat
MAL13P1.127 chr13: 958583 A/A Fp(2/1) T C gatgaatttgttgtaacgttt acgttaataacaatcatgtga
MAL14.5217 chr14: 2364467 A/A Fp(3/0) A A ggtatatcctttctacatat aattcttttcatagggagtt
PF14_0565 chr14: 2428920 A/T Fn(16/23) T A atcgtcaataccttcctcg taaacaaaatatgagcactg
  1. Gene ID, gene ID or SNP ID in PlasmoDB; Chr position, chromosomal position of the polymorphic site; Mism Alle, mismatched alleles of our array calls and known NIAID SNP between 3D7 and 7G8; SFPn, calls not matching known SNP, either false positive (Fp) or false negative (Fn). The numbers in the parentheses are numbers of probes calling for SFP or no SFP. For example, Fp(3/0) indicates three probes called for a SFP and no probe called for no SFP, but there was no known SNP in the databases; and Fn(0/3) indicates three probes called for no SFP, but a known SNP existed (false negative); 3D7, alleles obtained from sequencing 3D7 DNA; and 7G8, alleles obtained from sequencing 7G8 DNA sequences. The gene ID in italic indicates SNP not confirmed by sequencing (true wrong calls) using 1.5 cutoff ratio and 3–23 positions in a probe; and those in bold had additional polymorphisms supporting the array calls. TAT in MAL12.3146 is a trinucleotide missing in 7G8. Forward and reverse are primers used in amplification and sequencing of the PCR products.
\