Skip to main content

Advertisement

Table 3 Primers used for amplification of large fragments in Crassostrea. hongkongensis mitochondrial genome

From: Complete mitochondrial DNA sequence of oyster Crassostrea hongkongensis-a case of "Tandem duplication-random loss" for genome rearrangement in Crassostrea?

Order Primer name Sequence (5'-3') Amplification conditions* Product size (bp)
1 RCOIA Mt133 GGTCAACAAATCATAAAGATATTGG CCGGTCTGAACTCAAATCA 35× (94°C 1 min, 57°C for 1.5 min, 72°C for 1.5 min) 2325
2 Mt89 1R CAGTACCTGCCCAGTGCGACAT GGCTTAATTACGGCTGGTGTTT 35× (94°C 1 min, 57.5°C for 1.5 min, 72°C for .5 min) 2626
3 CYF 12-B TTAGAGTTCCGTTTCACCCG CTTTCGCTGCGGTTTAGTTAGT 35× (94°C 1 min, 47.5°C for 1 min, 72°C for 1.5 min) 2448
4 12-F 12B GGTTCTGGTCTAATGTTCGCT GTTACTCTCCCTTTACTCCC 35× (94°C 1 min, 47°C for 1 min, 72°C for 1 min) 804
5 12RF ATP-H GTAGGTCAGGACGAAGTGCT AGAGCACAGGTGTTGGGAGA 35× (94°C 1 min, 49°C for 1 min, 72°C for 1 min) 996
6 727F DNR TATTCGCCCTGACACTCTTAC TCCCGTATTCCAGAAGAAGCAG 35× (94°C 1 min, 77.5°C for 1 min, 72°C for 1.5 min) 2444
7 ND2F 5NR AGATTTGCTGGTTTTCCTCCG CTGATGTTGTAAGTCCCGCAC 35× (94°C 1 min, 49.5°C for 1 min, 72°C for 1.5 min) 2641
8 ND6F2 NDR GCTCCTACTCCTGTCTCATC TGACGCTTGCGAATAAGACAC 35× (94°C 1 min, 49°C for 1 min, 72°C for 1 min) 948
9 ND5F RND GAGGATTTACTGCGGTGATTGG GTCAGAGCCATTCCGACTATC 35× (94°C 1 min, 47.5°C for 1 min, 72°C for 1.5 min) 1373
10 FLeu NO1 GCCAGGTTAGTGTGGTATTTAG GAGTAAGTGGATAAGGGTGGA 35× (94°C 1 min, 47.5°C for 1 min, 72°C for 1.5 min) 2017
  1. * Steps of initial 94°C for 2 min at the beginning and final 72°C for 5 min after 35 cycles are omitted in cycling profile of each primer pair in the table.