Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 3 Primers used for amplification of large fragments in Crassostrea. hongkongensis mitochondrial genome

From: Complete mitochondrial DNA sequence of oyster Crassostrea hongkongensis-a case of "Tandem duplication-random loss" for genome rearrangement in Crassostrea?

Order Primer name Sequence (5'-3') Amplification conditions* Product size (bp)
1 RCOIA
Mt133
GGTCAACAAATCATAAAGATATTGG
CCGGTCTGAACTCAAATCA
35× (94°C 1 min, 57°C for 1.5 min, 72°C for 1.5 min) 2325
2 Mt89
1R
CAGTACCTGCCCAGTGCGACAT
GGCTTAATTACGGCTGGTGTTT
35× (94°C 1 min, 57.5°C for 1.5 min, 72°C for .5 min) 2626
3 CYF
12-B
TTAGAGTTCCGTTTCACCCG
CTTTCGCTGCGGTTTAGTTAGT
35× (94°C 1 min, 47.5°C for 1 min, 72°C for 1.5 min) 2448
4 12-F
12B
GGTTCTGGTCTAATGTTCGCT
GTTACTCTCCCTTTACTCCC
35× (94°C 1 min, 47°C for 1 min, 72°C for 1 min) 804
5 12RF
ATP-H
GTAGGTCAGGACGAAGTGCT
AGAGCACAGGTGTTGGGAGA
35× (94°C 1 min, 49°C for 1 min, 72°C for 1 min) 996
6 727F
DNR
TATTCGCCCTGACACTCTTAC
TCCCGTATTCCAGAAGAAGCAG
35× (94°C 1 min, 77.5°C for 1 min, 72°C for 1.5 min) 2444
7 ND2F
5NR
AGATTTGCTGGTTTTCCTCCG
CTGATGTTGTAAGTCCCGCAC
35× (94°C 1 min, 49.5°C for 1 min, 72°C for 1.5 min) 2641
8 ND6F2
NDR
GCTCCTACTCCTGTCTCATC
TGACGCTTGCGAATAAGACAC
35× (94°C 1 min, 49°C for 1 min, 72°C for 1 min) 948
9 ND5F
RND
GAGGATTTACTGCGGTGATTGG
GTCAGAGCCATTCCGACTATC
35× (94°C 1 min, 47.5°C for 1 min, 72°C for 1.5 min) 1373
10 FLeu
NO1
GCCAGGTTAGTGTGGTATTTAG
GAGTAAGTGGATAAGGGTGGA
35× (94°C 1 min, 47.5°C for 1 min, 72°C for 1.5 min) 2017
  1. * Steps of initial 94°C for 2 min at the beginning and final 72°C for 5 min after 35 cycles are omitted in cycling profile of each primer pair in the table.