transcriptional module | gene | prosecutor rank | motif rank | motif sequence in the intergenic region of either the gene or its operon | literature reference |
---|---|---|---|---|---|
ArgR Amino acid biosynthesis: Arginine. AUC 0.92 | artJ | 21 | 8 | TGCATAACATTGCG | [56] |
 | aroP | 58 | 39 | TGATTTTTAATTCA | [57] |
 | artI | 131 | 50 | TGCATAATTATTCT | [56] |
 | hisL | 16 | 4 | TGAATAAACATTCA | putative |
 | pyrL | 32 | 61 | TGACTTTTAATTCA | putative |
 | metH | 36 | 76 | TGAATTTTTATTAA | putative |
 | ydcS | 43 | 63 | TGAATAAATTTTCT | putative |
 | stpA | 132 | 21 | TGCATTTTTATTCA | putative |
 | hisG | 141 | 8 | TGAATAAACATTCA | putative |
 | hisJ | 144 | 27 | TGCATTGAAATGCA | putative |
 | hisC | 145 | 13 | TGAATAAACATTCA | putative |
 | hisA | 147 | 14 | TGAATAAACATTCA | putative |
 | potF | 162 | 46 | TGCATAAAAATTTG | putative |
CysB Amino acid biosynthesis: Cysteine AUC 0.91 | sbp | 12 | 0 | CGCAAGTTATAGCCAATCTTTTTTTATTCTT | |
 | nlpA | 36 | 17 | CAGACTTTATATTCCACTTTTATTCCTTTTT | [48] |
 | mmuP | 28 | 40 | AACGCGGTATAACAAACCTTCTTTGGATGTT | putative |
Fur iron regulatory gene AUC 0.84 | yncD | 74 | 32 | GGGAATGGTAATCATTATT | [44] |
 | ybaN | 37 | 5 | GAAAATGATAATTGTTATG | putative |
 | folE | 101 | 29 | GGCAATTACAATAATTATC | putative |
LexA major regulator of DNA repair AUC 0.87 | yebG | 0 | 21 | CTGTATAAAATCACAG | |
 | dinI | 2 | 6 | CTGTATAAATAACCAG | |
 | dinB | 6 | 51 | CTGTATACTTTACCAG | [63] |
 | dinD | 19 | 0 | CTGTATATAAATACAG | [45] |
 | yjiW | 39 | 20 | CTGATGATATATACAG | [45] |
 | ybfE | 120 | 31 | CTGATTAAAAACCCAG | [45] |
 | sbmC | 125 | 4 | CTGTATATAAAAACAG | [64] |
MetJ Amino acid biosynthesis: Methionine AUC 0.88 | ybdH | 10 | 6 | AGACGTTTAGATGTCT | [65] |
 | ybdL | 106 | 0 | AGACATCTAAACGTCT | [65] |
 | ycbK | 198 | 17 | AGTCATCTTGACGTCT | [65] |
 | mmuP | 14 | 15 | GGATGTTTAGATGTCC | putative |