Skip to main content

Advertisement

Table 1 Real-time qPCR analyses

From: Local and systemic gene expression responses of Atlantic salmon (Salmo salar L.) to infection with the salmon louse (Lepeophtheirus salmonis)

Target Primer sequence from 5' to 3' Amplicon size (bp) Accesion number
Matrix metalloproteinase 13 F CCAAAAAGAGGGCACCAGATGG 53 DW539943
  R CCAAAAAGAGGGCACCAGATGG   
Matrix metalloproteinase 9 F AGTCTACGGTAGCAGCAATGAAGGC 72 CA342769
  R CGTCAAAGGTCTGGTAGGAGCGTAT   
Cathepsin S F CGAAGGGAGGTCTGGGAGAGGAAT 87 CA355014
  R GCCCAGGTCATAGGTGTGCATGTC   
Bone morphogenetic protein 4 F TCAAGTTGCCCATAGTCAGT 207 CA056395
  R CACCTGAACTCTACCAACCA   
Alkaline phosphatase F CTAGTTTGGGTCGTGGTATGT 185 CA358635
  R TGAGGGCATTCTTCAAAGTA   
Heat shock protein 90β-20 F GAACCTCTGCAAGCTCATGAAGGA 72 CF752846
  R ACCAGCCTGTTTGACACAGTCACCT   
Collagen 10α F TGGTGCTCTTTGACTGCCTGTAA 180 EG837148
  R CATCCTGTGTGTTGCAATATCACA   
Collagen 1α F AGAGAGGAGTCATGGGACCCGTT 155  
  R GGGTCCTGGAAGTCCCTGGAAT   
Collagen 2α F TGGTCGTTCTGGAGAGACT 151 BX865386
  R CCTCATGTACCTCAAGGGAT   
Decorin F GAACCTGGCTAAGCTGGGTCTAA 256 DQ452069
  R GAACAGGCTGATGCCAGAGTACAT   
Elastin F GAGGCTACAGACCAGGAGGAGTT 226 BU694149
  R TCTGGGTCGGTGGGTTTGTA   
Laminin F CATGTGACATGGACACAGGAA 273 DY722974
  R CGTCCTCAGCCTCATAGGTGTA   
CCAAT/enhancer binding protein β F TACGTCCTGGGCTATCCTGAACTGC 140 CA348284
  R CCAGACGAACCGTTGTTGTCCA   
Erythroid 5-aminolevulinate synthas F CACATGAGACAGCTGCTCCTGGAGA 121 DW580939
  R GCTCCAGCAAGATGTCACACACCT   
Heme oxygenase 1 F AGTCAGTGGAGAGAGACCTGGAGCA 117 CA363120
  R GGTTGTCTTTGCCGATCTGTCTGAG   
Haemoglobin beta chain F ACAAACGTCAACATGGTCGACTGG 67 NM_001123666
  R TCTTTCCCCACAGGCCTACGAT   
Mannose binding lectin 1 F TCCATTGCACTGGGCGATGC 105 CA349943
  R CACTGCTTCCACCTGAGCCTCA   
Prostaglandin D synthase F CCTACACCAACCTGAACGCTGATG 98 CA352578
  R ACGCTGGCTGGTGAAGGTGAAG   
MHC class II α chain F AGTCAGGTGGACCAGGAACAATCA 96 CA379977
  R CTGGAGAACTGGTTGAGGGTGAAA   
CD8α F CGTCTACAGCTGTGCATCAATCAA 266 AY693391
  R GGCTGTGGTCATTGGTGTAGTC   
IL-12β F TCTACCTACACGACATTGTCCAGCC 62 AJ548830
  R ATCCATCACCTGGCACTTCATCC   
Arginase 1 F AGCCATGCGTATCAGCCAA 122 EG929369
  AAGGCGATCCACCTCAGTCA   
Programmed death ligand 1 F TCAACGACTCTGGGGTGTACCGATG 133 CA366631
  R TCCACCTCATCTCCACCACGTCTC   
Beta-2-microglobulin F TCGTTGTACTTGTGCTCATTTACAGC 107 AF180478
  R CAGGGTATTCTTATCTCCAAAGTTGC   
TGF-β F AATCGGAGAGTTGCTGTGTGCGA 332 EU082211+
  R GGGTTGTGGTGCTTATACAGAGCCA   AJ007836
IL-1 receptor type 1 F CCAAAAAGAGGGCACCAGATGG 126 NM_001123633
  R CGTATCGTCTCTCCAACACCTCAGG   
CD4 F TGCATTGTTCCTCTCTTCCACAGC 128 EG852912
  R CCGTCCCAAGGTACCATAGTACCAA   
IL-10 F ATGAGGCTAATGACGAGCTGGAGA 54 EF165028
  R GGTGTAGAATGCCTTCGTCCAACA   
Eukaryotic translation initiation factor 3 subunit 6 F GTCGCCGTACCAGCAGGTGATT 92 CX040383
  R CGTGGGCCATCTTCTTCTCGA