Skip to main content

Table 2 Novel human miRNA* sequences identified by cloning from NB

From: New miRNAs cloned from neuroblastoma

Sequence name Sequence Chromosomal location Northern blot validation Reads Notes
HSA-MIR-188* ctcccacatgcagggtttgca Xp11.22 - 1 3'-arm
HSA-MIR-106b* ccgcactgtgggtacttgctgc 7q22.1 + 5 3'-arm
HSA-MIR-423* tgaggggcagagagcgaga 17q11.2 + 1 5'-arm
HSA-MIR-594* cctaagccagggattgtgggtt 7q34 - 1 5'-arm
HSA-MIR-342* aggggtgctatctgtgattgagg 11q32.2 + 1 5'-arm
HSA-MIR-490* ccatggatctccaggtgggt 7q33 - 2 5'-arm
HSA-MIR-361* cccccaggtgtgattctgatttg Xq21.1 + 3 3'-arm
HSA-MIR-28* cactagattgtgagctcctgga 3q28 - 1 3'-arm
HSA-MIR-127* ctgaagctcagagggctctgat 14q32.31 - 1 5'-arm
HSA-MIR-214* tgcctgtctacacttgctgtgca 1q24.3 + 2 5'-arm
  1. Notes give the information which hairpin arm expresses the miRNA* form.