Skip to main content

Advertisement

Table 2 Markers developed and cloning and sequencing primers for mapping

From: Genomic characterization of putative allergen genes in peach/almond and their synteny with apple

Gene Primer sequence1 Tm °C2 Cycles3 Allele length (nt)4
Pru du 1.01 For-ATGGGTGTCTTCACATATGAGAG Rev-CTGACAACATATATACTGTAAC C 58 35 T-218
Pru p 1.01 For-TCATACAGCTACACCTTGT T Rev-CAATGAGCTTGAAGAGATTTG 58 35 E-205
Pru p/du 1.02 For-GTTGGAACCATCAAGAAGGAC GTTT CATGAGCATACAGAACTATC 58 35 T-188 E-179
Pru p/du 1.03 For-GGTGAAGGTTAGCTAGTTGA Rev-GTTT CCATCCCTGTGCTTCACAA 58 35 T-153 E-150
Pru p/du 1.04 For-CTTTGGTGAAGGTAAGTTTAGA Rev-GTTT CATACCTGTAAGTGCTACCTGC 58 35 T-157 E-164
Pru p/du 1.05 For-GCTTCCAACATCAAGTAATACCT Rev-G TTTGGGACTAGGTTGTCAGCA 60 35 T-179 E-182
Pru p/du 1.06A For-TAGTTATGAGTTGCTTGCAATGCT Rev-GAAAGTTCCAAAGTACATGTGC 58 35 1871, sequencing
Pru du 1.06B For-ATCCCCAAGATTGATCCCCT G Rev-GATTAGAATTTAAGAGCTTACTGT 60/58 5/35 T-182
Pru p 1.06B For-AAAGCCCTTGTTCTTGAAGCG Rev-GATTAGAATTTTAGAGCTTACTC C 60/58 5/35 E-212
Pru p/du 1.06C For-CTAATTAATAACATAAATCTTGAAAC T Rev-TTGATCTCAACATCCCCTGC 56/54 5/35 E-272
Pru du 2.01A For-CTTAGCATTCAACCAGCCT C Rev-GATGAGGTAGTCAGGGCA AG 60 35 T-175
Pru p 2.01A For-CAATTGTCTCTGTAATCTGTTT Rev-ACGGAGCGTCCACAGAGTT 60 35 E-205
Pru du 2.01B For-TTGCCCTGCCAATGTTAACGC Rev-GCACTGGGTCTTAAAGAACT G 60 35 T-187
Pru p 2.01B For-CAATTGTCTCTGTAATCTTTAG Rev-GGTCTTGAAGAGCTTAGAGTGA 60 35 E-622
Pru p/du 2.02 For-AAGAATCCATCAACTGAATCC Rev-CTACTAGGGTCTTCATCATCGG 56 40 T-271 E-315
Pru p/du 2.03 For-ACATGCGCCTCTGCGGACTA Rev-CCATTTCTTGCACGATTCAA 60 30 T-237 E-229
Pru p/du 2.04 For-TCAGTGTCAGGCTGTCAGTG Rev-CTCCAGATTCAGAGAGGTGC 60 35 T-267 E-235
Pru p/du 3.01 For-CACCATGCATACCCTACGTG Rev-CGTGAGGAATCCCTAAGTGG 60 35 530, sequencing
Pru p/du 3.02 For-CTTACCCCAATGCAAATGCT Rev-CCACTGAAACCAACAGCAGA 60 35 319, sequencing
Pru p/du 3.03 For-AGGCAGCCCTTACTTGTCCT Rev-CCACATGCTTCTCCGTATCA 60 35 413, sequencing
Pru p/du 4.01 For-AGAAGAAATCAGAAGCAACG Rev1-CAAGATACAACCCAGTTGC G Rev2-CTTTGTCCCACCAAGGAATAGA 55 35 T-276 E-631
Pru du 4.02 For-AAGTACATGGTCATCCAAGC C Rev-GTCCCTGAAATTGAAGTGTC 58 35 T-188
Pru p 4.02 For-GGCAACCACCTCTCTC CT Rev-CAAGATACAACCCAGTTGC G 55 35 E-363
  1. 1Designed mismatching nucleotides are in bold and underlined, added pigtail bases in bold and italics.
  2. 2, Annealing temperature (Tm)
  3. 3Number of PCR cycles. In the case of two values, a touch-down PCR was performed in two steps: the first number of the "Tm" and "Cycles" column refers to the Tm and number of cycles, respectively, of the first step.
  4. 4T and E refer to parental source from 'Texas' almond and 'Earlygold' peach, respectively. Genes mapped by direct sequencing are indicated by 'sequencing'