Skip to main content

Advertisement

Table 4 PCR primer pairs used for genomic cloning of the different peach/almond allergen genes and for (bin) mapping the genes

From: Genomic characterization of putative allergen genes in peach/almond and their synteny with apple

Primers group Reference Sequence1 Primer name Primer sequence (5' – 3') Tm °C/cycles Product Gene
     Pfu Taq (nt)  
1 DQ251187 PpPr10f PpPr10r ACCATGGGTGTCTTCACATA AATTTAGTTGTAGGCATCGG 56/30 58/2 586/623 Pru p/du 1.01/05
2 DY646736 Pp1-2f Pp1-2r GTTTGTCCTTTAAACTCTCC GATTTAGTTGTAGGCATCGG 53/30 55/2 762/765 Pru p/du 1.02
3 DY647300 Pp1-3f Pp1-3r CTTTGATCAGTTTCCCAAGT TTAGTTGTAGGCATCAGGGT 53/30 55/2 624 Pru p/du 1.03
4 DY653062 Pp1-4f1 Pp1-4r TTTACAGAATCATGGGTGTG TTAGTTGTAGGCATCATGGT 53/30 55/2 615/622 Pru p/du 1.04
5 GW1 Pp1-1A-GSP1 Pp1-1A-GSP2 AACCTTCACCAAAGCTAGTCTTCTTGATG GTCAGCATCCAGAACAAGGGCTTTGAACA    1100 Pru p/du 1.05 /6A/C
6 GW2 P1-1A3-GSP1 P1-1A3-GSP2 GGTGTCTTCACATACTCAGACGAGTC CCACCTCAGTCATCCCCCCACCAAGA    1546 Pru p/du 1.06A/C
7   P1-1-6 PpPr10r CACCTCCAGTGCTCATAGC See above 57/30 59/2 720 Pru p/du 1.05
8   P1-7f P1-7r ATGGGTGTCTTCACATACTCAG TTTAGTTGTAGGCATCTGGGT 57/30 59/2 593 Pru p/du 1.06A/B
9   P1-8f P1-8r2 TAGTTATGAGTTGCTTGCAATGCT GGGCATGCTTGCTTTGGTAACTC 58/30 60/2 1346 Pru p/du 1.06C
10   P1-8f P1-9r See above GAAAGTTCCAAAGTACATGTGC 58/30 60/2 1908 Pru p/du 1.06A
11 AF362988 PpTL2f PpTL2r ACAGCAAGCCAATTAAGACA GCTTATGGGCAGAATGTGATGAG 56/30 58/2 879/892 Pru p/du 2.01A/B
12 AF362987 PpTL1f PpTL1r ATGATGAAGACCCTAGGAGCAG GTCGAGAGTCCTATCTTTAT 56/30 58/2 974 Pru p/du 2.02
13 GW3 PTLP1-GSP1 PTLP1-GSP2 GATAATTGAGGATTTCCAAAGGAGGCTG AGGAGGGTTAAGCTGAGGCTGAGGACTG    500/1500 Pru p/du 2.02
14 BF717226, DW349103 PpTLP3f PpTLP3r AAGTAAAGTTCTTTGGCGTC CACGTGGCACCACAAGCATC 53/30 55/2 659 Pru p/du 2.03
15 GW4 PruTLP3-GSP1 PruTLP3-GSP2 AGTACTCACCCACCAACTTCTCCTGCGT GCTACTTTAGCCGAGTTCACTCTCAACG    800/1000 Pru p/du 2.03
16 Consensus of 29 ESTs PpTLP4f PpTLP4r ACTTGTCTGAACTTATGGCTCC GAAGTTAGAAGAAGAGCTGCG 58/30 60/2 1800/1825 Pru p/du 2.04
17 AY620230 X96714 PpLTP1f1 PpLTP1r ATCATAGTCAAGAGAGATGG CCCTAAGTGGATCACATAGC 52/30 54/2 645 Pru p/du 3.01
18 AY093699 X96716 PpLTP2f PpLTP2r TATCAGCTTTACTTACGACG CTGGCTTCCACAGAAACCTC 58/30 60/2 513/514 Pru p/du 3.02
19 X96715 PpLTP3f PpLTP3r CCCAAGCGAAAGAAACACTA CATCTCATATCATCCTTCCA 58/30 60/2 527/528 Pru p/du 3.03
20 AJ491881 AY081852 Pp4.01f Pp4.01r AGAAGAAATCAGAAGCAACG AAATAGTCACTCGGAGCAAT 51/30 53/2 1041 Pru p/du 4.01
21 AJ491882 Pp4.02f Pp4.02r1 CAGCAACAACAACAAAGATG TCTAGAGACCCTGCTCAACC 53/30 55/2 754 Pru p/du 4.02
  1. 1GW-genome walking, only gene specific primers (GSP) shown, according to sequences obtained with previous primer group, representative reference EST accessions for group 16: [GenBank:DY634569; DY644567; DY651848; DY634415]