Skip to main content

Table 2 Validation of differential gene expression observed in microarray experiments via qPCR.

From: Global transcriptional profiling reveals Streptococcus agalactiae genes controlled by the MtaR transcription factor

Gene mRNA level change Sense primer sequence (5'-3') Antisense primer sequence (5'-3')
  qRT-PCR microarray   
SAN_1753 -2.1 -2.4 GGGTTGGGAAGGTGCTTAC TAAACCTCCAATAAGGAACGAC
SAN_1754 -3.0 -2.4 ATGGAATTGTCGGTTATTCAGGAG GTCAGTGTCACCTTGTTGTCG
SAN_1756 -6.5 -5.3 GCTCCAATTCGTATCTATTCTG ATTTGATTAAACCTGCTGACTG
SAN_0595 -3.7 -2.4 AAGATAGTGCTCTCCTTCAAAC CCCTTTCCCAAGATATTTCTCC
SAN_0596 -1.6 -2.4 GCAGGGATTATTGTTGAGC GAAGTCTCTTGTGCGGATTTC
SAN_1755 -6.0 -3.7 GCAGATGAGGTAGAACAGTGG GTGCGGTAATGTGACCTTTATC
SAN_2186 -3.7 -3.2 AATATAAGTTAGGTGCCGTATCTG CGTGTTGTTAGTAGGTGTCTC
SAN_1255 -3.2 -2.7 AAACCCAAATCCTCACATTATTG TCCCATCTTTACATTGACTTCG
SAN_0156 -1.7 -2.6 ATATAAAGGTTCTGCCAAAGTC TGTATAAGTTGCTAAGTTCTCATC
SAN_0157 -2.8 -2.9 TTGGACATCATCTAATGGCTTAC ATATGGCGGTCAATAGGAAATG
SAN_0597 -2.1 -2.0 GGCGGGATTGAGAGGTAAAC TAACGGACATCATAACTAACTGC
SAN_0933 +1.7 +2.5 CAGAAATAAGGCATCAACTACC AAAGAATAGGCATTATCAATACG