Skip to main content

Table 4 qPCR primers for selected candidates

From: Biomphalaria glabrata transcriptome: cDNA microarray profiling identifies resistant- and susceptible-specific gene expression in haemocytes from snail strains exposed to Schistosoma mansoni

Primer name Gene name Sequence 5'-3' Product size (bp) R/Sa
DY523263F Unknown ACGTAGGAGACTGAGGGCACC 151 S
DY523263R   CAAATCCTCAAATATGCACGAAAC   
EW996837F Unknown AACCGAATCAGAGGCGACAG 143 S
EW996837R   CCGAGCATGGAATGGAAGAG   
DY523267F Unknown TGGTGATAAATGCTCTGGTAGCTC 117 S
DY523267R   CAGCAATATAATCAAAGGGCAATG   
EW996814F Unknown GTGAAGAATTGAGGATTGAACATCC 113 S
EW996814R   GAACCACCACATAGCGCAAAG   
EW996975F ODC1 ACTTTTGATAAGGTGGGTTCTTCG 135 R
EW996975R   TGCTGAATCTATCCGACTGGC   
EW997032F Unknown TTAGTTGCAGGAGGAGGCTTAGC 116 R
EW997032R   CCGCTTGCACCGTATGATG   
CO870193F Unknown CAACTGGGTTGGGATCGTG 130 R
CO870193R   CCTGAACAATTCGGTCTCAGC   
CK656720F Unknown AAACTTGATGTGCGACTGATGG 96 R
CK656720R   CAAAATCATCTTCTGGGTAAAGGG   
CK149228F Titin GTGAATCTGAACCATGCGACTTAG 106 R
CK149228R   GCACCATCGTCAATCGTACG   
ACTINRTF Actin TATGTGCAAGGCAGGTTTCG 113 C
ACTINRTR   AGCTGTCCTTCTGACCCATACC   
  1. a R – resistant associated, S- susceptible associated, C- control.