Skip to main content

Table 1 List of putative reference genes and genes of interest

From: Tracking the best reference genes for RT-qPCR data normalization in filamentous fungi

Name Annotation GO terms Pathway Primer sequence Primers efficiency Amplicon size
R1 DUF221 domain protein (DUF221) Vacuolar membrane (GO:0005774) Transmembrane protein with unknown function Fw: CGGAACGCCCCATTGACC 95.1% 126 bp
Rv: TTGGATGCTTATGTTTTGCTCTCG
R2 Ubiquitin carrier protein (ubcB) Ligase activity (GO:0016874) Involved in the ubiquitin mediated proteolysis Fw: TCGTTGAGTAGACTCTGAATGCTG 99.2% 125 bp
Cellular response to stress (GO:0033554)
Rv: AGCCAGATGTTCCACCCG
Cytoplasm (GO:0005737)
R3 CECR1 family adenosine deaminase (ADA) Adenosine deaminase activity (GO:0004000) Involved in the purin metabolism Fw: CTGCGCAATGCAAAGTCATGTCTCTG 100.7% 97 bp
Rv: CCCAGGTCGAAGATCCCTTTATCCA
R4 Mitochondrial membrane fission protein (fis1) Metal ion binding (GO:0046872) Mitochondrial complex that promotes mitochondrial fission Fw: GTTCAACTACGCCTGGGGACTC 101.1% 91 bp
Mitochondrial fission (GO:0000266)
Rv: AGCGGTGCGAAAAATCTGGG
Membrane (GO:0016020)
R5 Copper-transporting ATPase (Cu-ATPase) Nucleotide binding (GO:0000166)   Fw: TGGTGCCCTGTGCCAACTCTCCCAGTC 103.6% 78 bp
Cellular metal ion homeostasis (GO:0006875)
Rv: TTGCTGCGGGTGCTTTTG
Membrane (GO:0016020)
R6 Cohesin complex subunit (psm1) DNA secondary structure binding (GO:0000217) Involved in chromosomes segregation during mitosis Fw: GTATTTGCGGAGATCCAGAGTGAG 93.1% 102 bp
Mitotic sister chromatid segregation (GO:0000070) Rv: TTGAAGACGGGTCTGTTCCA
Nucleus (GO:0005634)
R7 Spo7-like protein (spo7) Phosphatase activity (GO:0016791) Involved in the spore formation process Fw: GCCGATGGTGCTGATGTTGG 102.5% 110 bp
Sporulation (GO:0043934)
Rv: AGAACGCCAACGAGCCCG
Integral to membrane (GO:0016021)
R8 SAGA-like transcriptional regulatory complex subunit Spt3 (spt3) Transferase activity (GO:0016740) Component of the nuclosomal histone acetyltransferase (SAGA) complex Fw: ACGACTTGTTGGCGGACG 96.3% 95 bp
Chromatin modification (GO:0016568)
Rv: GAGATTCAGCAGATGATGTTTGTC
Nucleus (GO:0005634)
R9 DUF500 domain protein (DUF500) Actin filament organization (GO:0007015) Cytoskeleton organization Fw: ACTTGGCCGGTTGTGCGTTC 98.5% 101 bp
Cytoplasm (GO:0005737) Rv: TTGGTGTTCCGGCGGCTG
R10 Rho GTPase activator (sac7) Rho GTPase activator activity (GO:0005100) Involved in signal transduction Fw: AGGAGGATGAAAGTAAAGGACCCC 100.5% 159 bp
Small GTPase mediated signal transduction (GO:0007264)
Rv: AAACCCCACACTTGGCGAC
Intracellular (GO:0005622)
R11 AP-2 adaptor complex subunit beta (AP-2 β) Transporter activity (GO:0005215) Involved in chlatrin-dependent endocytosis Fw: TTTCGCACATAGGGGTCG 98.4% 148 bp
Rv: TTTTGGTCGATGATATGGACG
R12 Protein translocation complex componenet (npl1) Protein transporter activity (GO:0008565) Involved in the protein progression in endoplasmic reticulum Fw: CGCTGGAACAAGAAAAATACG 98.2% 117 bp
Post-translational protein targeting to membrane (GO:0006620)
Rv: ACGAACGATATGCGCCAA
Endoplasmic reticulum (GO:0005783)
β-tub Beta-tubulin Nucleotide binding (GO:0000166) Cytoskeleton Fw: GTTCTGGACGTTGCGCATCTG 97.2% 110 bp
Cytoskeleton (GO:0005856)
Rv: TGATGGCCGCTTCTGACTTCC
abf-B2* Arabinofuranosidase-B2 Hydrolase activity, acting on glycosyl bonds (GO:0016798) Sugar metabolism Fw: CGGAGCTTGGGTGAGATGGTTC 103.6% 112 bp
Carbohydrate metabolic process (GO:0005975) Rv: CGGCGGCGTTGCTAATGC
Extracellular region (GO:0005576)
xynC* Xylanase C Hydrolase activity, acting on glycosyl bonds (GO:0016798) Sugar metabolism Fw: CAAATGGCGACAATGGCG 94.4% 104 bp
Xylan metabolic process (GO:0045493) Rv: TGAGTACGTGACAGTCTGTGCATTG
Extracellular region (GO:0005576)
  1. The annotation and GO terms were taken from the Talaromyces versatilis genome (basionyme Penicillium funiculosum, ADISSEO proprietary sequence, unpublished). Forward (Fw) and reverse (Rv) primer sequences used for RT-qPCR. The two genes at the bottom of the table marked with an asterisk (*) correspond to the genes of interest.