Skip to main content

Table 5 Primers used for dsRNA template synthesis, for RNA probe synthesis for in situ hybridisation (ISH), southern probe synthesis and probe synthsis for cDNA blotting

From: Characterization of a novel RXR receptor in the salmon louse (Lepeophtheirus salmonis, Copepoda) regulating growth and female reproduction

Type of use

Sense strand

Antisense strand

dsRNAFr2, ISH 3′, southern

#CGGAATTGGGATGTCTACGAGCCATCATA

#CTTCCTCTGACTCACTATAGAAGCATA*

dsRNAFr1, ISH 3′

#CATGAGTGGAGGGGGTTCTATTGGGGATAT*

#GCGATGAGTTCAACTAGGACACGATCGAAT

ISH 5′

#GCCTCAACTCCTTGTTGTTCCTGCTT

#TCACACAATCCCGATTTTCTCTGCA

cDNA blot

CATCGAGAGGATCATTGAGGCAGAA

CGACTTGGCTCATTCTCATGAACAGA

  1. *These primers were used for both, dsRNA template synthesis and RNA probe synthesis for in situ measurement.
  2. #primers which were produced with and without T7 (TAATACGACTCACTATAGGG).
Back to article page

BMC Genomics

ISSN: 1471-2164

Contact us