Skip to main content

Table 2 Marker name, position and sequences of candidate SNP sex markers in pistachio

From: Identification of sex-linked SNP markers using RAD sequencing suggests ZW/ZZ sex determination in Pistacia vera L.

No Marker name SNPs Positions Sequence (5′-3′)
1 SNP-PIS-1319 Y-Y 28-77 AATTCGTATAGCCCGTGAGAATACATG(Y)GGATGAGGGCTATACATGAGAGAGAGTACACTCACATGGCCAAGGGTT(Y)CGAAT
2 SNP-PIS-29689 Y-R 33-71 AATTCAACATCTTATAAAGCGAAATCACTTCA(Y)AATAATGCTTCTTCTTTGCAAGTGCACCAAACAATAT(R)TTGAATGATGA
3 SNP-PIS-112277 Y-R 10-61 AATTCGTTA(Y)CTAGAGGGTGATTTTAAAACTCTTACAGACACAAAACCATGACAATAATT(R)AAGGAAGAAAATTCAGCATGC
4 SNP-PIS-120693 M-W 19-57 AATTCAATGATCTAGATT(M)AAAGAAGGCATTGGATGTTGTGTATTGTCATTTGTAA(W)AATATCTTGGTGTGTAAAATGTGTA
5 SNP-PIS-127343 S 27 AATTCACCAATATTTTACTGCAATAA(S)TAAGAATGTAATGACAGGGTGAGTGAAAATGGTAGATTAAAATTTTAAGGAAATG
6 SNP-PIS-133396 S-Y 46-47 AATTCTCCTCTGTTTTTTGGGCAAACCGCAAAGAAGATTAAAGTA(S)(Y)TGATCCATGATCTTCAAGTTTCAGTACTATTCATA
7 SNP-PIS-135862 Y-Y 40-41 AATTCTTTGGTTTTGTGTCTGAATGTGGATAATATATGG(Y)(Y)GCCTCATGTTGATTATGGGAAATGTGCATGGAAATAGTATC
8 SNP-PIS-136404 K 23 AATTCTTTTAGGGGTTGTCAAA(K)TGACCGGATTCCTCACAAATTCAATTGCCAACTCTAAAGCTGGCAAGAAATTCTTTAGC
9 SNP-PIS-167992 W 36 AATTCAAACGAAAAATAACTTCATAGCGTGAGCTC(W)TTGTTCCACCTSTAACCGCAACCCTAAGCTGCAATTGATCACTTCC
10 SNP-PIS-174431 M 56 AATTCCATTACTTCAACAAGTCTCTAGCCGCGTACATATAAAAATTAACTACTCA(M)AGTGAAAGTGGAYAAATTGTTAAGTT
11 SNP-PIS-176863 R 57 AATTCCACATTTGACMAGGGTTGGAACTTTTGAGGTGGATGTGAGCTTGGAAGGTA(R)TATCATACTTTGCAGACAGGTCGAT