Identification of novel and salt-responsive miRNAs to explore miRNA-mediated regulatory network of salt stress response in radish (Raphanus sativus L.)

Table 5 **Novel miRNAs with their complementary miRNA*s under salt stress in radish**

miRNA	Sequence (5′–3′)	Length (nt)	Precursor length (nt)	Count		MFE (kcal/mol)	Arm	miRNA location
miRNA	Sequence (5′–3′)	Length (nt)	Precursor length (nt)	CK	Na200	MFE (kcal/mol)	Arm	miRNA location
rsa-mir2-5p	AAAUCAUACUUUCAUUGAUA	20	185	277	0	−71.3	5′	CL10794.Contig2
rsa-mir2-3p	UCAAUGAAAGGUAUGAUUCCC	21	185	277	1,228	−71.3	3′	CL10794.Contig2
rsa-mir4-5p	ACGUUUCUCGAACUCAAGACC	21	107	0	3	−64.5	5′	FY453420
rsa-mir4-3p	UCUUGAGUUCGAGGGACGCCA	21	107	115	193	−64.5	3′	FY453420
rsa-mir11-5p	AGGCGAUGAUGGAUACCGAGAA	22	91	310	0	−31.8	5′	CL2420.Contig13
rsa-mir11-3p	CUCGGUAGCGAUGGUUCAAUCUCG	24	91	1	0	−31.8	3′	CL2420.Contig13
rsa-mir13-5p	AUAUACUGAAGUUUAUACUCU	21	208	33	57	−33.5	5′	EY928450
rsa-mir13-3p	AUCAUAAAAUCUUCAUUAUCUAG	23	208	1	1	−33.5	3′	EY928450
rsa-mir22-5p	UGGUGCAGGUCGGGAACUGAU	21	110	13	0	−57.7	5′	EY910368
rsa-mir22-3p	CGGAUCCCGCCUUGUAUCAAG	21	110	1	0	−57.7	3′	EY910368
rsa-mir24-5p	CGGUUAGCUUGGAAGCCAAAA	21	178	0	1	−41.2	5′	CL10961.Contig1
rsa-mir24-3p	UUGUUUUCUGAGAAAAUGGGC	21	178	0	10	−41.2	3′	CL10961.Contig1
rsa-mir35b-5p	UCGACGGGAAGGGGCUUUCUCU	22	72	0	1	−20	5′	CL7248.Contig2
rsa-mir35b-3p	GGAAUGUUGUUUGGCUCGAAG	21	72	94	64	−20	3′	CL7248.Contig2

ISSN: 1471-2164