Skip to main content

Table 5 Novel miRNAs with their complementary miRNA*s under salt stress in radish

From: Identification of novel and salt-responsive miRNAs to explore miRNA-mediated regulatory network of salt stress response in radish (Raphanus sativus L.)

miRNA Sequence (5′–3′) Length (nt) Precursor length (nt) Count MFE (kcal/mol) Arm miRNA location
CK Na200
rsa-mir2-5p AAAUCAUACUUUCAUUGAUA 20 185 277 0 −71.3 5′ CL10794.Contig2
rsa-mir2-3p UCAAUGAAAGGUAUGAUUCCC 21 185 277 1,228 −71.3 3′ CL10794.Contig2
rsa-mir4-5p ACGUUUCUCGAACUCAAGACC 21 107 0 3 −64.5 5′ FY453420
rsa-mir4-3p UCUUGAGUUCGAGGGACGCCA 21 107 115 193 −64.5 3′ FY453420
rsa-mir11-5p AGGCGAUGAUGGAUACCGAGAA 22 91 310 0 −31.8 5′ CL2420.Contig13
rsa-mir11-3p CUCGGUAGCGAUGGUUCAAUCUCG 24 91 1 0 −31.8 3′ CL2420.Contig13
rsa-mir13-5p AUAUACUGAAGUUUAUACUCU 21 208 33 57 −33.5 5′ EY928450
rsa-mir13-3p AUCAUAAAAUCUUCAUUAUCUAG 23 208 1 1 −33.5 3′ EY928450
rsa-mir22-5p UGGUGCAGGUCGGGAACUGAU 21 110 13 0 −57.7 5′ EY910368
rsa-mir22-3p CGGAUCCCGCCUUGUAUCAAG 21 110 1 0 −57.7 3′ EY910368
rsa-mir24-5p CGGUUAGCUUGGAAGCCAAAA 21 178 0 1 −41.2 5′ CL10961.Contig1
rsa-mir24-3p UUGUUUUCUGAGAAAAUGGGC 21 178 0 10 −41.2 3′ CL10961.Contig1
rsa-mir35b-5p UCGACGGGAAGGGGCUUUCUCU 22 72 0 1 −20 5′ CL7248.Contig2
rsa-mir35b-3p GGAAUGUUGUUUGGCUCGAAG 21 72 94 64 −20 3′ CL7248.Contig2
  1. MFE (kcal/mol), minimal folding free energy.