Skip to main content

Table 1 Primers for bisulfite sequencing

From: DNA methylation of the LIN28 pseudogene family

LIN28P-Ch:7 Forward GAAAAGTTTATGAAAGAGGTTAGGGTT
  Reverse AAAACCCTCCATATACAACTTACTC
LIN28P-Ch:28 Forward TTTTAAGAAGTTTATTAAGGGTTTGGAA
  Reverse TAACCCCCACCCACTATAACTTAAT
LIN28P-Ch:3 Forward GTATATAATGGGGAGTAGGGGTT
  Reverse CAAAAACCCTCCAAATACAACTTAC
LIN28 Forward TTTTTTTAGAGTAAGTTGTATATGGAGGG
  Reverse TTACCAAAAACCACAAACTTCACTT