Skip to main content

Table 6 True Seq adapter sequences

From: Global scale transcriptome analysis of Arabidopsis embryogenesis in vitro

Sample ID Adapter sequence (5′ - > 3′)
SE_5D GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
SE_10D GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
SE_15D GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG
WT_L GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG