Skip to main content

Advertisement

Table 3 Oligonucleotides used in this study for PCR genotyping and DNA sequencing

From: Genome sequencing of the Trichoderma reesei QM9136 mutant identifies a truncation of the transcriptional regulator XYR1 as the cause for its cellulase-negative phenotype

Primer name 5′-3′ sequence
PCR genotyping  
Pxyr1-ver-F AAGGATGCCGACTTAACGAAC
Txyr1-ver-R AGTCGCTCATGATCCTACCAG
Xyr1-ver-R CCTGGCAGCAATAAGAGAGC
Xyr1-ver-F CCTTGCGGATAAGTGGGATC
5Pxyr1-ver-F CCAGCTGCCACTCTCATG
GFP-ver-R AAGCACTGCACGCCGTA
GFP-ver-F TACGGCGTGCAGTGCTTC
Pgpdh-ver-F TGCTAAGGTACCTAGGGAGGGA
hph-ver-R CAAGCACTTCCGGAATCG
act-mp-F ACTTTCGGCCGCATTCTG
act-mp-R AGCCAGGATCTTCATCAGGTAG
DNA sequencing  
Pxyr1-seq-F GACAGCAGCAGTAGTCAGGT
Txyr1-seq-F TTGCTGAAAGTGAAGAGGG
xyr1-seq-F CCGTCTCCCAAGACTAGC
5′xyr1-seq-F CACATTGAGGGCTCTGTC
3′xyr1-seq-F AAGCATCTGCCATTGTCC
Xyr1∆A2294-seq-F GCCACGATGCAGGGAA
3′GFP-seq-F CCGACAACCACTACCTGA
5′GFP-seq-F GCCACAAGTTCAGCGTG
Pgpdh-seq-F CATGCAGTTGCTAAGGTACC
Tgpdh-seq-R GACTGTGAGCATGTGATGGC