Skip to main content

Advertisement

Table 4 RT-qPCR primers used in this study

From: Genome sequencing of the Trichoderma reesei QM9136 mutant identifies a truncation of the transcriptional regulator XYR1 as the cause for its cellulase-negative phenotype

Gene Primer name 5′-3′ Sequence R 2 Efficiency
cel7a qPCR-cel7a-F CCGAGCTTGGTAGTTACTCTG 0.990 0.98
qPCR-cel7a-R GGTAGCCTTCTTGAACTGAGT
xyn2 qPCR-xyn2-F CAACCAGCCGTCCATCATCG 0.993 0.97
qPCR-xyn2-R ATCGTCCCGAGCGTCAGG
xyr1 qPCR-xyr1-F CCATCAACCTTCTAGACGAC 0.987 0.99
qPCR-xyr1-R AACCCTGCAGGAGATAGAC
cre1 qPCR-cre1-F GTCTGAGAAACCTGTCCCTG 0.996 0.91
qPCR-cre1-R GGCTAATGATGTCGGTAAGTG
tef1 qPCR-tef1-F CCACATTGCCTGCAAGTTCGC 0.995 0.95
qPCR-tef1-R GTCGGTGAAAGCCTCAACGCA