Skip to main content

Table 1 The forward and reverse primers used in validation experiment of gene expression by qRT-PCR.

From: Transcriptome sequencing and analysis of rubber tree (Hevea brasiliensis Muell.) to discover putative genes associated with tapping panel dryness (TPD)

Genes Directions Sequences Length (bp) Annealing Temperature (°C)
DXR Forward CATTGGGACTCAGACATTGGACATC 215 63
  Reverse CTTGCTCCCCAGGAATAATCTCAG   
HMGR1 Forward GGCTGTGGATGATGATGAGGAGGAG 135 63
  Reverse GGAGAAGAAACAACTGCCCGTGAC   
MVK Forward ACTTAGGTGCTCCTTCCTCTTCAAC 182 64
  Reverse GACAACTACGGTGGCAGGCTTA   
GPPS2 Forward GGCAAGCGTGTCCGTCCAGTTTT 299 64
  Reverse TCAGCAATGGCTCTAACCACTCG   
13-LOX3 Forward ATGGAGAAAAGGGAAGAGTTGATAG 248 63
  Reverse ATAAGGGAAATGCCAATAACAGTC   
AOC4 Forward AGGTGATAGATACGAAGCAACATACAG 307 64
  Reverse AGGAATAGTCCCAGAAGACAAAGTG   
12-OPR Forward CTCACCCGAGAAGTCATACCAAAT 278 63
  Reverse CCAACAGTGCCCACAGCCAT   
18 s rRNA Forward TCTCAACCATAAACGATGCCGACC 118 63
  Reverse TTCAGCCTTGCGACCATACTCCC