Skip to main content

Table 6 Characteristics of the 30 analyzed simple sequence repeat (SSR) markers and the diversity detected in 32 Barbarea accessions

From: Expression patterns, molecular markers and genetic diversity of insect-susceptible and resistant Barbarea genotypes by comparative transcriptome analysis

Marker Motif Primer sequence (5′to 3′) MAF GNo ANo GD H PIC
BV13-17 (TC)6 ACAGGAAGAATGAGAAGAGCT 0.76 3.00 2.00 0.37 0.06 0.30
   TCTGTTTGTGGTTTTAATGGGC       
BV13-18 (T)12 TCAATGAAGACTATTTGAGATGCT 0.97 2.00 2.00 0.06 0.00 0.06
   CTTCAATAACTCCCTTACCAATGT       
BV13-65 (TGT)4 TCCTGCTGCTACTGTTGTTG 0.79 2.00 2.00 0.33 0.00 0.28
   TCAGAAACGGCATCCCTCTA       
BV13-92 (T)13 TGCGAATCAATCTTTCATTTGT 0.55 3.00 2.00 0.50 0.30 0.37
   TGTAGGTTTCTTTGGTTGCCA       
BV13-98 (TTC)5 GGCTTCTTCTCCTTTTACTTCCT 0.42 6.00 4.00 0.69 0.45 0.64
   GTGGACATGGTGGAAGGTTT       
BV13-103 (TGA)5 AAGCCCTCCAAACCAAGATG 0.85 5.00 3.00 0.27 0.06 0.25
   AAGCACAGATGATGCCAGAG       
BV13-108 (TCC)5 GGCGGTGGTGGATCTTATTA 0.88 2.00 2.00 0.21 0.00 0.19
   ATTTAGCACCACCACCTGAG       
BV13-112 (TTG)4 TGGTTTCGAGATGGGTTTCT 0.61 4.00 3.00 0.54 0.25 0.48
   ACCAATCCTCCAAGACAACA       
BV13-123 (T)8 GGCTGTGCAATCCTGAGTAA 0.88 6.00 3.00 0.22 0.09 0.21
   AGGAAGATGGATAATTTAAGCAGA       
BV13-125 (T)9 TCCACGAATCTTGCTTCTTTCT 0.86 3.00 2.00 0.24 0.15 0.21
   GACTATTTCTCTGTTGTTTTGAAGT       
BV13-146 (GAA)5 GGAGTCCTTCTGTCACTTCC 0.58 3.00 2.00 0.49 0.24 0.37
   CGTCATCGTCGGTGATACTC       
BV13-174 (A)11 CGTTCAAGGCACATCAGAGT 0.44 8.00 6.00 0.71 0.33 0.66
   TTCAAACACGGTAGTAGCGC       
BV13-339 (GGC)6 GTTCTTCTGCCGACGGTAAG 0.79 3.00 3.00 0.36 0.00 0.33
   GAGGAGGAGTTGAAGGCATG       
BV13-370 (GAA)5 GCAATGTGAGGATCATCACG 0.89 3.00 2.00 0.19 0.15 0.17
   AGTTGATGAAATCGCTGCAG       
BV13-372 (TGA)6 TGGCTTGGTTTGGTAGATGA 0.44 4.00 5.00 0.69 0.59 0.64
   GGTTTCTGCATCGACGAATG       
BV13-375 (GCG)6 CGTTCAAGGCACATCAGAGT 0.47 7.00 5.00 0.68 0.33 0.63
   TTCAAACACGGTAGTAGCGC       
BV13-417 (G)10 AGCCCTCTTGAGAACATTAAGA 0.70 3.00 2.00 0.42 0.06 0.33
   AAGTCTTTGTCTTTTGCTGC       
BV13-425 (TC)7 TAGAGGACGACGGAGACAAC 0.71 6.00 3.00 0.45 0.33 0.41
   TCATCATCAAAGGAGAATCGGA       
BV13-426 (CT)8 GAAACCTACACAAATAACAGAATGT 0.52 7.00 4.00 0.65 0.33 0.60
   GAACCGCATGTCTTAATTCGT       
BV13-436 (A)11 ACGATCATTTTGAGGTTTGAGA 0.38 8.00 4.00 0.71 0.36 0.66
   CTCTCTGGAATCACTGCACA       
BV13-439 (A)10 CCAACACCGAACGCATAAGA 0.68 3.00 2.00 0.43 0.09 0.34
   TCGCACTAATGTCTCCAACT       
BV13-443 (CTC)5 CGTTCCTTTACCCACTCGTC 0.39 4.00 4.00 0.71 0.33 0.66
   CGGTTTTAACAAGCTCGTCG       
BV13-445 (TCTT)5 CACATAACTCAGAACCGGACA 0.45 4.00 4.00 0.67 0.27 0.62
   TCCTCTGTTTCTCACTAAGTAGA       
BV13-462 (T)11 CTGCACAGACGACTCTTTT 0.83 3.00 2.00 0.28 0.03 0.24
   CCGATCCTCTTCTCCACCTT       
BV13-485 (T)12 TCGGTTTTGTTGCTTCCCAT 0.79 2.00 2.00 0.33 0.00 0.28
   TGCATTAGAGAGATTTCAAGTCC       
BV13-509 (T)10 ACGAAGGAGAAAGAACTTGCA 0.79 5.00 3.00 0.35 0.21 0.32
   TCTTTAGAGAGCAAGAAAGAGATAA       
BV13-542 (CGA)6 CAGGTTTCGCTCAGAGGAAG 0.33 7.00 5.00 0.74 0.47 0.69
   CTCTCGCGCTCTGAATCAAT       
BV13-544 (TCC)5 ACGCCAGGATGAATCTCAAC 0.77 3.00 2.00 0.35 0.09 0.29
   TTTCAGATTCGTCGCGGAAA       
BV13-557 (CCA)5 TAGCTTCCTCATTCCCACCA 0.88 2.00 2.00 0.21 0.00 0.19
   CCGTAATGAAACCTGGAGCA       
BV13-558 (GA)8 AGAGAGAAAACGAGAGAGAGAGA 0.81 3.00 2.00 0.30 0.25 0.26
   AAACATGGAACCAGCTTGCT       
BV13-564 (GGT)6 GAGGGAACGTTGGTGGTT 0.50 5.00 3.00 0.56 0.27 0.47
   ACGACGGCTGTTTACACTTT       
  1. MAF, major allele frequency; GNo, genotype number; ANo, allele number; GD, gene diversity; H, heterozygosity; PIC, polymorphism information content.