Skip to main content

Table 3 List of the primers used in quantitative real-time PCR analysis in the leaf tissue of Vandana and IR64 under control and drought conditions

From: Identification of four functionally important microRNA families with contrasting differential expression profiles between drought-tolerant and susceptible rice leaf at vegetative stage

Gene Sequence
miR397a Forward primer 5′ TCATTGAGTGCAGCGTTGATG 3′
miR397b Forward primer 5′ TTATTGAGTGCAGCGTTGATG 3′
miR528-5p Forward primer 5′ TGGAAGGGGCATGCAGAGGAG 3′
Ascorbate oxidase (Os06g37150) Forward primer 5′ GGAGAGGACAGTTCGAGTGC 3′
Reverse primer 5′ TAAGTCTTCCCCTGCTCGAC 3′
U6 snRNA Forward primer 5′ TACAGATAAGATTAGCATGGCCCC-3′