Skip to main content

Table 6 Conversion of SNP markers identified from genotyping markers on genetic linkage map flanking the R gene PhtjR into sequence-specific PCR markers suitable for genotyping by high resolution melting (HRM) with LightScanner

From: Application of whole genome re-sequencing data in the development of diagnostic DNA markers tightly linked to a disease-resistance locus for marker-assisted selection in lupin (Lupinus angustifolius)

Marker Primers Primer sequence (5′-3′)
DAFWA926 DAFWA926F GGTTGGGTTAACTTTTATGTCTAAAATC
DAFWA926R GGTAAGTTTATTTTTCTAAAGTTGAAC
DAFWA2836 DAFWA2836F CACATAAGAATATGGAAATGGAGA
DAFWA2836R CTGTAAACTGAAGGTGGGCATT
DAFWA3794 DAFWA3794F GAAAGGAGAAAACTAATCAACATAAG
DAFWA3794R ATTAGGGTTTGAGATAGAGTAACAT
DAFWA2747 DAFWA2747F CCTAACTTCCGATCCAGTAAGC
DAFWA2747R CTTTGATCGCTTGGGTTTC
DAFWA6277 DAFWA6277F TTCGGGAATTTGTATGAGCT
DAFWA6277R GGATGGATTCAAAGGTTCAAG
DAFWA8077 DAFWA8077F GAGATTATTTTCACAAGCTTCCTC
DAFWA8077R CCTTTTAGCTTATTCAATTAGCTTG
DAFWA6895 DAFWA6895F TGAAGGTCCAATACCAGCAAG
DAFWA6895R CAACTTCCCTGGAGCAAAA
DAFWA4020 DAFWA4020F CTAGATAGTTTCGTTTTATCATAC
DAFWA4020R GACATAAAGCTTATATATTTGCA
DAFWA3123 DAFWA3123F CCCTGGACTCTCTCCCTGTATT
DAFWA3123R GAATGAAAGTTTGATATGCATAATAA
DAFWA4021 DAFWA4021F GCTCAGAAACGGTGTCGTT
DAFWA4021R GAAGACCTCCAAAACCAAAGC