Skip to main content

Table 2 Primers for QRT-PCR

From: Transcriptome profiling of wheat glumes in wild emmer, hulled landraces and modern cultivars

Gene Gene ID Forward (5’ – 3’) Reverse (5’ – 3’)
CCR Ta1alLoc003924.2 TGCCGTGAGAAGAAGGTGAT CTTCTCTGCCATCGTCTTGC
COBRA Ta5asLoc003744.1 CGTCGCCGTTGAAGTAGATCT TCATCGCAAGGATGATAGAAC
CesA-1 Ta5alLoc000723.1 GTCAAGCAAGAACAGCAT ACCAGCTACCCACAAGAGCAA
FLA Ta3bLoc003710.1 CAGTACCCGCTCAACGTCAC CCGGTGTAGAGCGTGTTGTC
FST Ta3bLoc056384.1 TGAACATGAGCAAGCTGGAG CCATTCTGTCTCCCATGTCC
LAC16 Ta4asLoc013789.1 GTCCGATCTACCCGTCTGTT GTGTGTTTATGCAAACCAAAGG
LAC Ta4blLoc021918.2 GCAGAAGGTGACACGGCTAT GCCTTCCCTTGTGACGATT
CesA-2 Ta5alLoc000723.1 ATCAGGCTTTGATTTCAGCAA TGGATGTCATGTCAAGCAAGA
6-SFT Ta6bsLoc005412.1 AGCTGTCAGTGAGGGTGCTT CGTTGGGTACACTCGTGATG