Skip to main content

Table 3 EST-SSRs tested empirically in two Eudicotyledoneae genera, Trifolium and Centaurea

From: Mining microsatellite markers from public expressed sequence tags databases for the study of threatened plants

Locus GenBank accession No. Species Primer sequences Repeat motif Expected size (bp) N A Size range (bp)
Forward Reverse
T6-Trifolium gi86106666 T. pratense CAACCAGTGGTGTGAGTAGGAG ACGTTGGTGGAGAGGTTGAG (AG)11 110–128 2 114–116
gi86105378
T7-Trifolium gi428283538 T. repens ATCACGCTTCACTCCTCCAC CAACTCCAAGCTTAAGATCGTGTA (AG)13 110–122   no PCR product
T1-Trifolium gi428292074 T. repens AGATTCCCACCAATCTCCCT CAATACGCGGGTCTTGATCT (AG)11 210–228 --- 257–261
T2-Trifolium gi86106666 T. pratense TTCCGGTTAGGTTAGGGTTT TTTTCACATCTTCCGAAGCC (AAT)7 110–113   no PCR product
gi86105378
T3-Trifolium gi428285635 T. repens CACCACATATGCAACCACAA GTCGACGACGGTTGTTACCT (AGT)8 110–126   no PCR product
T8-Trifolium gi428291122 T. repens GCAAAACTCAAGAGAACGGC GGATGTCTTCGGAGGTGAGA (ACC)7 110–122   no PCR product
T9-Trifolium gi428292435 T. repens ACAACCCATTTGCCTCAAAG TTTTCACTTCCACCACCTCC (ACC)7 110–133 2 124–127
T10-Trifolium gi86119186 T. pratense TCCACTAGTTCTAGAGCGGC TCCTGTAAACTGGAGGAGCC (ACC)9 110–153   no PCR product
T11-Trifolium gi86124411 T. pratense TGGCGGTGGTGACTTATACA TGTTTGGCAGTGGTGATGTT (AGG)8 110–153   no PCR product
T4-Trifolium gi86125686 T. pratense GCTGCCACAGCACTACCAG AATATTACCGTGAATGAAGCTCAG (ACC)8 110–113 1 110
T5-Trifolium gi86097190 T. pratense TGAGTTCCGAGTTAAGGCTCA TTCGGTAACTCCGAGGATTG (ACCT)5 210–217 2 227–230
T12-Trifolium gi428282514 T. repens GATTATTCAACCAAACGCCG TAGAAAGCCACGCCAAGACT (AATCC)20 290   no PCR product
C6-Centaurea gi124618051 C. maculosa TGGGATGCAGTCCAGTCATA TTGCAACTTGCCTGTACCAC (AC)11 160–162 1 256
C1-Centaurea gi148298213 C. maculosa GGGAACCACACCTTTCATCT GATCTGGCTTGACCCAAGAA (AC)10 90–119 2 99–101
C7-Centaurea gi124669731
gi124688599
C. solstitialis TCGTTTTCCGATCACAAACTC CAATTTGGCGACATCTCCTT (AC)12 110–160 4 114–152
C2-Centaurea gi124680442 C. solstitialis CGCATTATGGAATAAACCCG GCTTTCGACTTCATAAGCGG (AAG)7 140–152 1 147
C8-Centaurea gi148296795 C. maculosa CGATGTATACAGGTGGTGCG GGAGAAGGGGAGACGTAAGG (ACC)7 110–150 2 141–144
C9-Centaurea gi124675484 C. solstitialis AACGGTAGGAACCAGCATTG GATCCTCTGGCAGGGTCATA (ACC)9 260–302 4 290–299
C10-Centaurea gi124661102 C. solstitialis AGTTGCCAGAAAGGAGCAAG TCGAGAACAATGGCCTATCC (AGC)7 210–229   no PCR product
C11-Centaurea gi148292432 C. maculosa TCCATGGATACAACCACCAA GCGATATTCGGATGCAAAGT (AGG)7 160–175 4 160–172
C3-Centaurea gi124632630 C. maculosa GCCATCCCCTTCTCTACTCC GTTACAGGTGACGATGGGG (AGT)7 160–181   no PCR product
C4-Centaurea gi124691992 C. solstitialis CTGCACCTACCCAGAGAAGC CGGGAGAGGGTAAATTGTGA (AGGT)5 110–115 3 103–109
C12-Centaurea gi124632477 C. maculosa ATGCATTGAGAAGGCCAATC AACTCGCAAGCCTTTTCAAG (AATCGG)4 210–223   no PCR product
C5-Centaurea gi124673348 C. solstitialis TTAAGCATTCTTCGAGGCGT TCTATGCCTACGCCGATCTC (AAGCAG)5 110   no PCR product
gi124676118
gi124669484
  1. GenBank accession No., identification number of the EST sequences (when more than one ID refers to consensus sequence); species, indicates the species of the EST sequences; primer sequences; type of repeated motif; expected size of the PCR product; N A, number of alleles for the examined individuals and size range of the PCR product (−− indicates stutter peak)