Skip to main content

Table 1 Primers for new markers successfully mapped near the Qcrs.cpi-3B locus#

From: Fine mapping of a large-effect QTL conferring Fusarium crown rot resistance on the long arm of chromosome 3B in hexaploid wheat

Marker Forward primer/position (bp) Reverse primer/position (bp) Product size (bp)
CS3BLCR-01 AAACAGAGTAACAGACCGACC/773070474 TTCAGATAAGGAAACCAAACA/773070830 357
CS3BLCR-02 CATACATACTCCCTCTGTTACCT/773095727 CTTCCCTTTGCTGCGTGT/773096117 391
CS3BLCR-03 GGTCTCTTCGCTGACAAA/750842960 CCTTGCTTGCTTATGTGCT/750843318 359
CS3BLCR-04 GCTTTGAGTTATGTATCCGTG/770066939 TAAGAAACCAGCGTCAGAAA/770067148 210
CS3BLCR-05 ATCTGGGATAATGAGGTGG/770736229 GAAGACCAACATAGTAATCGG/770736554 326
CS3BLCR-06 TCCTTATTCCTCTTCCCTAAA/770210969 TTGACTTGTTTCTTATGTCCTG/770211217 249
CS3BLCR-07 GAGGGAGGTCTGGTTGGG/770225517 AAGCGGAGTGTTGTGTTG/770225671 155
CS3BLCR-08 TGATTACAACAAACAAACCC/770294691 ATACACTGAACAAACGGATAA/770294978 288
CS3BLCR-09 GTAGAAATAGGGACAACGGAG/770304690 ACAAGAAACGGCAGATGA/770305044 355
CS3BLCR-10 AAAGCCACCTAATGAAGAAAC/770331178 GAAGAAGAAGAGGAGCGG/770331485 308
CS3BLCR-11 TGTTGTTTGGGTAGTCATTCT/770349503 GCTCCAGTGCTTGTAGTCA/770349800 298
CS3BLCR-12 AAGAAGAGGAGCAGCAAAG/770552012 AAAGCCACCTAATGAAGAAAC/770552259 248
CS3BLCR-13 ATGGAGGAGACGAAACTCA/770843419 GTTATCTTGGTATGCGGGT/770843678 260
  1. #Primer positions and the product sizes were based on those reported in the chromosome 3B pseudomolecule; the annealing temperature used for all of the primer sets was 55 °C