Skip to main content

Table 4 RT-qPCR primer pairs used for amplification of target genes

From: Differential responsiveness of Holstein and Angus dermal fibroblasts to LPS challenge occurs without major differences in the methylome

Gene Forward Primer Sequence Reverse Primer Sequence Reference
TLR4 ACTGCAGCTTCAACCGTATC TAAAGGCTCTGCACACATCA [42]
IL8 GCTGGCTGTTGCTCTCTTG AGGTGTGGAATGTGTTTTTATGC [43]
TNF TCTTCTCAAGCCTCAAGTAA CCATGAGGGCATTGGCATAC [44]
CCL20 TTCGACTGCTGTCTCCGATA GCACAACTTGTTTCACCCACT [5]
CCL5 CTGCCTTCGCTGTCCTCCTGATG TTCTCTGGGTTGGCGCACACCTG [5]
ACTB GCAAATGCTTCTAGGCGGACT CAATCTCATCTCGTTTTCTGCG [43]