Skip to main content

Table 3 List of primers designed for qRT-PCR validation of RNA-seq data

From: RNA-sequencing of the sturgeon Acipenser baeri provides insights into expression dynamics of morphogenic differentiation and developmental regulatory genes in early versus late developmental stages

Unigene Id Gene name Primers
comp134704_c0_seq1 Sex determining F:5ʹAGTCCTGACGCTGGGTATGC 3ʹ
Region Y-Box 17 (sox17) R:5ʹGTCGCCGTATCCGAGGTTC 3ʹ
comp135742_c0_seq2 SIX homeobox 3a (six3a) F:5ʹTTATCCCTCCCATTTCTTCCTG 3ʹ
R:5ʹGAGAAGTTGAGGGTCGGTAGCT 3ʹ
comp137301_c0_seq3 homeobox D10 (HOXD10) F:5ʹGCTCTCCTGCTGCTAATACCTT 3ʹ
R:5ʹCGGCAGTAGTCCACAGGTTT 3ʹ
comp141980_c0_seq1 wingless-type MMTV integration site family, member 11B (wnt11b) F:5ʹGTAGCCTCGGCCACAGCA 3ʹ
R:5ʹGCAGACCTCAAGTCCAAATACCT 3ʹ
comp128400_c0_seq2 EYA transcriptional coactivator and phosphatase 3 (eya3) F:5ʹACCCACCTGGCTGCGAGT 3ʹ
R:5ʹGGACGAAGCCCTGGAACTG 3ʹ
comp118626_c0_seq1 actin, beta (Actb) F:5ʹAGGTCCTTACGGATGTCAACG 3ʹ
R:5ʹGCGTTTCAGGTGCCCAGA 3ʹ