Skip to main content

Advertisement

Table 3 Eight genomic segments within loci that inhibit glial cell differentiation

From: Stringent comparative sequence analysis reveals SOX10 as a putative inhibitor of glial cell differentiation

Element ID UCSC Coordinatesa SOX10 Consensus Sequenceb
Notch1-R1 chr3:9,307,836-9,308,296 ACAATGGGGCCTCTGT
Notch1-R2 chr3:9,308,175-9,309,096 ACAATCGGCTTTGT
Hmga2-R1 chr7:65,390,088-65,391,287 CTTAGACACAGCACTT
Hmga2-R2 chr7:65,427,912-65,428,606 ACACAGGCCCCTCTTTGT
Hes1-R1 chr11:77,415,315-77,415,779 TGTGTGAGCGCCATGTGT
Mycn-R1 chr6:51,229,947-51,230,533 ACAATGGCCTCTTTCTACAGACAAT
Id4-R1 chr17:18,701,460-18,702,118 ACAAAAACAGCAGTAAATGGAGGCCTTTGT
Id2-R1 chr6:53,090,794-53,091,254 ACAAGAAACACATTGT
  1. aCoordinates refer to the March 2012 UCSC Genome Browser Rat assembly (rn5)
  2. bSOX10 consensus sequences are indicated in bold, underlined text