Genome-wide analysis of G-quadruplexes in herpesvirus genomes

BMC Genomics

Table 1 Presence of repetitive G-quadruplex motif (RGQM) in herpesvirus genome

Virus name	Sequence	Nucleotide position	n[max]	Percentage Conservation	Genome Location
HHV-1	GGGAGGAGCGGGGGGAGGAGCGGG	106–286 & 151968–152136	7	87.5	Repeat region
	GGGAGTGGGGGTGCGTGGGAGTGGGGG	5725–5873	7	87.5	Repeat region
	GGGGCTGGGGTTGGGGTTGGGG	71612–71792	8	100	Repeat region
	GGGGAGTGGGTGGGTGGGGAGTGGG	143736–143833	4	100	Repeat region
	GGGGGCGAGGGGCGGGAGGGGGCGAGGGG^a	25142–25448	8	87.5	Repeat region
	GGGGAGGGCTGGGGCCGGGGAGGGCTGGGG^a	25537–25692	3	100	Repeat region
	GGGAGGAGCGGGGGGAGGAGCGGG^a	26009–26177	8	75	Repeat region
HHV-2	GGGGCGGCTGGGGCAGGGGCGGCTGGGG	72102–72222	3	100	Repeat region
	GGGGGGACGGGGGGACGGGGGGACGGGGGG	133385–133489	5	100	Repeat region
	GGGGGTCGGGCGGGCGGGGGTCGGG	153828–154066	8	100	Repeat region
	GGGGGGCCGGGGGGACGGGGGGACGGGGGG^a	6406–6502	4	75	Repeat region
HHV-6A	GGGTTAGGGTTAGGGTTAGGG^a	75–411 & 151327–151645	14	100	Repeat region
HHV-6B	GGGTTAGGGTTAGGGTTAGGG^a	77–521, 8459–8669, 153410–153842, 161780–161990	18	–	Repeat region
HHV-7	GGGTTAGGGTTAGGGTTAGGG^a	82–222, 5938–8907, 8985–9923, 9195–9243, 9387–9651, 143128–143262, 148984–151965, 152031–152169, 152253–152349, 152445–152715	82	100	Repeat region
HHV-8	GGGATGGGGGTGTGGGATGGGGG	29928–30032	5	80	Repeat region

n[max] is the maximum number of iterations (n[max]) of a given RGQM
The percent conservation of each RGQM indicated in the tables is based on the presence of a minimum of three iterations of a given RGQM in all available sequences [i.e., HHV-1 (n = 8), HHV-2 (n = 3), HHV-3 (n = 52), HHV-4 (n = 5), HHV-5 (n = 47), HHV-6A (n = 3), HHV-6B (n = 1), HHV-7 (n = 2), HHV-8 (n = 5) for a given virus.]
^aRGQM present in the reverse complement of the strand represented in NCBI

ISSN: 1471-2164