Skip to main content

Table 3 PCR Primers: Proposed PCR primers to be used to amplify the 7 MLST loci

From: Genomic determination of minimum multi-locus sequence typing schemas to represent the genomic phylogeny of Mycoplasma hominis

Gene Forward Reverse
MHO_4840a
GENE-20
AATGAACCTATTTATTTTTTGGGTG AATTTTGAATAAACTGGTATTTCTTTG
MHO_0720a
GENE-58
CTGCTGCAGCACTTATTGC GAACGTGATAAAGGAACTACTCA and CGCGATAAAGGAACTACTCA b
secD GENE-94 GGATGGGATAGTTTTGTGC ATCTATTTTGATTTGTTGAACTACC
oppA
GENE-138
GTTACAGTTAAGAGCTTTGATG ATTGATATAGATCGGTTGGTTC
argS
GENE-183
CATGGCGGAGATATGATAGA TTGCATCATTTCCAACTTCTTC
hiss
GENE-236
CTTTTGAGTCAAGAAATAACTACAT TTTTTTTCATCTTCATTCAAATAAGCAA
MHO_1160a
GENE-265
TTTTAGAAGATTTTATTTGCCCACA and TTTAGAAGATTTTATTTGCCCGC b TAAAGTCGCCATTAGCCTG
tyrS
GENE-428
CTTGCTTCAAGGTTGAGATTTTA CTTTTGGTTTTATTTTCATTGTGTTG
dnaG
GENE-519
CTTCCCACTTCATCCTATTTC and ACTTTCCACTTCATCCTATTTCAA b GATTGGCCTGTTTCTTTCATTC
  1. a gene encoding a hypothetical protein. Gene name relates to annotation in ATCC 23114
  2. b due to SNP in the primer footprint, equal volumes of 2 primers are required to ensure amplification of the target.