Skip to main content

Advertisement

Table 3 PCR Primers: Proposed PCR primers to be used to amplify the 7 MLST loci

From: Genomic determination of minimum multi-locus sequence typing schemas to represent the genomic phylogeny of Mycoplasma hominis

Gene Forward Reverse
MHO_4840a GENE-20 AATGAACCTATTTATTTTTTGGGTG AATTTTGAATAAACTGGTATTTCTTTG
MHO_0720a GENE-58 CTGCTGCAGCACTTATTGC GAACGTGATAAAGGAACTACTCA and CGCGATAAAGGAACTACTCA b
secD GENE-94 GGATGGGATAGTTTTGTGC ATCTATTTTGATTTGTTGAACTACC
oppA GENE-138 GTTACAGTTAAGAGCTTTGATG ATTGATATAGATCGGTTGGTTC
argS GENE-183 CATGGCGGAGATATGATAGA TTGCATCATTTCCAACTTCTTC
hiss GENE-236 CTTTTGAGTCAAGAAATAACTACAT TTTTTTTCATCTTCATTCAAATAAGCAA
MHO_1160a GENE-265 TTTTAGAAGATTTTATTTGCCCACA and TTTAGAAGATTTTATTTGCCCGC b TAAAGTCGCCATTAGCCTG
tyrS GENE-428 CTTGCTTCAAGGTTGAGATTTTA CTTTTGGTTTTATTTTCATTGTGTTG
dnaG GENE-519 CTTCCCACTTCATCCTATTTC and ACTTTCCACTTCATCCTATTTCAA b GATTGGCCTGTTTCTTTCATTC
  1. a gene encoding a hypothetical protein. Gene name relates to annotation in ATCC 23114
  2. b due to SNP in the primer footprint, equal volumes of 2 primers are required to ensure amplification of the target.