Skip to main content

Table 3 8plex, 5plex and 9plex primers and respective cycling conditions. The gene name, primer sequence and amplicon size are reported. Lowercase letters in the gene sequences (8plex) represent the tails added in order to obtain the same annealing temperature

From: Comparative genomics of European avian pathogenic E. Coli (APEC)

9PLEX
Gene name Primer sequence 5′–3′ Amplicon size
astA F TGCCATCAACACAGTATATCC 116
astA R TCAGGTCGCGAGTGACGGC
irp2 F AAGGATTCGCTGTTACCGGAC 413
irp2 R AACTCCTGATACAGGTGGC
papC F TGATATCACGCAGTCAGTAGC 501
papC R CCGGCCATATTCACATAA
iucD F ACAAAAAGTTCTATCGCTTCC 714
iucD R CCTGATCCAGATGATGCTC
tsh F ACTATTCTCTGCAGGAAGTC 824
tsh R CTTCCGATGTTCTGAACGT
vat F TCCTGGGACATAATGGTCAG 981
vat R GTGTCAGAACGGAATTGT
cvi/cva F TGGTAGAATGTGCCAGAGCAAG 1181
cvi/cva R GAGCTGTTTGTAGCGAAGCC
ibeA F AGGCAGGTGTGCGCCGCGTAC 171
ibeA R TGGTGCTCCGGCAAACCATGC
sitA F AGGGGGCACAACTGATTCTCG 608
sitA R TACCGGGCCGTTTTCTGTGC
  1. Cycling conditions: 95 °C for 5mins (initial denaturation), followed by 35 cycles at 95 °C for 30s (denaturation), 55 °C for 30 s (annealing), and 72 °C for 120 s (polymerization) On completion of 35 cycles, a final polymerization was performed 72 °C for 600 s