Skip to main content

Table 1 Primers and annealing temperatures used for pyrosequencing

From: Exposure of bovine oocytes and embryos to elevated non-esterified fatty acid concentrations: integration of epigenetic and transcriptomic signatures in resultant blastocysts

  Forward primer Reverse primer Sequencing primer Annealing temperature
COL6A3 AGGGAAGGTTGTTTAGAGGA ACCTAAAAATACTAATAACTAATCCATCA GGTTTTATATATAAGTAAAAGAA 57 °C
APAF1 TTTGGATGTTTTGTTAGATTGTAGTT AACTTACCACTACTACCCTCTAC ATTGGGTTTTGTGTG 54 °C
RFC4 TATTTTAAAGGAGATTAGTTTTGGGTGTT CTCAATTCAATCATAACTCAATCCTATA ATTGATGTTGAGGTTGAAA 60 °C
PLSCR3 TGGTTTTGTTGTTTGGTAGTTAAT CTCATATAACCAAACCCTTAATCTATC AGTTTTTTTATTTTAGTAGTTGG 54 °C
ELOVL1 GTTTTGTAGAGTTGGTGAGTGTA ATTTACTATCTAACCAAATCACTTCAC AGTTGGTGAGTGTATG 59 °C
TBKBP1 AGAGATGAGAAGGTTAGAGATTTAAGTAT AACCCTACCACATCTACATCCTCATA GTTTTAAATTAGTTGGGAGATA 58 °C
ERCC1 TTTTTAGTTTGGATATATAGATATGGGA ACTCAACCCCACTCATCT GGATATATAGATATGGGAAATATT 52 °C
CELF2 AGGAGAGAGGTGGTAATAATAAAGTTATA AACCAAAACCCTTTTCTCCA GTTGGTGATGAATTTGTAG 53 °C
ZFAND6 TGGGGAGGAGTATATGTGTATT CTTATTCTACCATTACTACTATTCTATCTT ATATGTGTATTTTTTTTTATTATAT 55 °C
PREX1 GGTTGGGTATTTATGTTTAGAAATTAAGT ACCTTCTCTATAATATTTATTCCTCTACC ATTAAGTGAGAAGGTATTTG 56 °C
APPL2 GTAGGTTTTATGGGGAAATTATGTAT TTCCATACCCTACCTATAAAAAATCTTC GTTTTTTTTTTTTATTGGGTAGA 55 °C
GCLC GTTAAATGGATGAGGGAGTTTAT ATTTTACTTCCACTATACCTAACTTT TGAATTATAGTTTTTTTTTAAAGTG 52 °C