Skip to main content

Table 3 Descriptive statistics of novel Passiflora edulis microsatellite markers

From: Microsatellite marker development by partial sequencing of the sour passion fruit genome (Passiflora edulis Sims)

# Marker Primer Sequences 5′-3′ RepeatMotif Ta AlleleN Allele Size
Range (bp)
He Ho PIC
1 BrPe0032 F:TTGCACAATGACCAATGTTGT
R:CTGAGCACCTTGTCAAAATACA
(AT)13 60 °C 7 137–157 0.84 1.00 0.77
2 BrPe0028 F:CAAAAGGAACAGGGAAGA
R:GAAAGAGAGAAAGACAGAGA
(TA)6 55 °C 5 90–110 0.80 0.50 0.72
3 BrPe0024 F:CCCTACCTTTCTCTGCTT
R:CATCTCCTCTATCTCCTTC
(TC)7 55 °C 4 221–231 0.76 0.70 0.68
4 BrPe0031 F:AGGTCGGTGGGTGTGTTTAG
R:CATTCAACTCCCCAAAAGGT
(TA)9 60 °C 5 134–150 0.77 0.67 0.67
5 BrPe0014 F:AATATGGCTGGGGAAAAC
R:TTCCTGTCTTTGGACCTT
(AG)7 57 °C 5 215–227 0.75 0.50 0.67
6 BrPe0033 F:GCCATGAGAGACTTGGGAGA
R:CGGTTGCCAAAAAGAAGAGA
(AT)8 60 °C 5 237–249 0.72 0.30 0.65
7 BrPe0038 F:TTTCAACTTTTCGTGTGTGC
R:TGTTGTTGCTTGGAAGGATG
(AT)6 60 °C 5 154–176 0.73 0.60 0.64
8 BrPe0042 F:CATGCATTCATTTGTTTTTCTTG
R:GATGCTGGGAAAAAGAGTGC
(AT)8 60 °C 6 142–160 0.71 0.80 0.63
9 BrPe0003 F:CTTTCTCTCCCTATACCC
R:CCCTCCATAATCACATAAC
(TC)11 55 °C 5 277–291 0.70 0.40 0.62
10 BrPe0043 F:TCATACATGGATGTCAAATCGATAC
R:GCGGACCAAGAAAATTCAAA
(AT)8 60 °C 4 199–207 0.71 0.50 0.60
11 BrPe0006 F:AAGGAAAAGAACAGCCTCA
R:CGCTCTCAAATCAGTCAAA
(TC)10 55 °C 4 193–199 0.68 0.40 0.59
12 BrPe0002 F:AAAGCCCAGATGAAGTGAA
R:GGCTCCAATCAGAAGTGT
(AG)12 55 °C 3 177–185 0.69 0.56 0.58
13 BrPe0021 F:ACTTCCTCATCATTCG
R:GCTATGCCTCTTTTTG
(TA)7 55 °C 3 158–164 0.67 0.25 0.56
14 BrPe0036 F:TCGGACCTTAAAACCGAGAA
R:CAGCACCAAAATTTGACGAG
(TC)6 60 °C 4 197–203 0.65 0.10 0.54
15 BrPe0023 F:AGATACCACACCCAATAG
R:TTGGAGTTGTTGGGGA
(CT)7 55 °C 6 118–132 0.57 0.40 0.52
16 BrPe3011 F:CCGGTCTTCCTGATTGACTC
R:CCTCTCTCACCTGGAACTGC
(TTC)4 60 °C 3 157–163 0.62 0.30 0.50
17 BrPe0037 F:TGATAATGCAGCGAAAGAGC
R:TCACACTCCATTTGCTCTGC
(TG)6 60 °C 3 227–231 0.61 0.20 0.49
18 BrPe0010 F:GAAGAAAAAAGGGCTTG
R:GTTAGGGTTTGGAGGA
(TC)9 55 °C 3 200–204 0.60 0.40 0.48
19 BrPe0001 F:GTTGAGAGGATTGTGTTTG
R:ATGGTAGAGGAGGAGAGA
(CT)14 55 °C 3 143–157 0.56 0.14 0.46
20 BrPe0012 F:AGAGAGAGAGAGAGAG
R:ACATCATACTCCTCATCC
(AG)8 55 °C 3 214–218 0.58 0.13 0.45
21 BrPe0008 F:TTTTCAGCCTCCACTCTT
R:TACACCACCAACACTCAC
(AG)9 55 °C 3 264–274 0.57 1.00 0.44
22 BrPe0025 F:CAAGGAACCAGAACAAGAAGAA
R:GAAGAACAAGCCAGCCCA
(GA)6 55 °C 3 114–126 0.57 0.11 0.44
23 BrPe0039 F:GCTGCTCCACTGTGAATGTC
R:AACCTAGCCCCGTCACAGTA
(AT)6 60 3 193–203 0.57 0.10 0.44
24 BrPe0050 F:TCAAGGGTATCTTTGGTGCTG
R:AGCTTCAGCGAGACAAAACC
(TG)7 60 °C 3 197–205 0.56 0.20 0.44
25 BrPe0013 F:GATCGAGGTGAGGTACTG
R:GGTTTGGCTTTAATGGAGG
(AG)8 55 °C 2 169–171 0.53 0.00 0.38
26 BrPe0020 F:TAAAGCATCAGGTCAG
R:TAGATAGATTTGACGGG
(GT)7 55 °C 2 295–297 0.53 0.00 0.38
27 BrPe0034 F:CCTGTGGTGAAAATGGAACC
R:GAGCCCTGGACTGACACATT
(CT)15 60 °C 2 217–227 0.56 1.00 0.38
28 BrPe0049 F:GGGAATCAAAACCATGCAGT
R:CTCCCAGCTTCCACTCACTC
(TA)9 60 °C 2 189–191 0.53 0.11 0.38
29 BrPe3012 F:CGCCCTTTCTGAAGATAATCC
R:GCAATGCTAAGAAGGCCAAG
(TCT)4 60 °C 2 181–183 0.53 0.11 0.38
30 BrPe0018 F:TCCTTCCTTCTCCTCC
R:ACACTTGTCTCTCATCT
(CT)7 55 °C 3 135–149 0.43 0.30 0.37
31 BrPe0022 F:GGCATAGAAGTGGAAGGG
R:GGAAGGGAAGTGAAGGGA
(AG)7 55 °C 2 98–104 0.51 0.20 0.37
32 BrPe0047 F:TGGGCCATTTCTTTTCTCTC
R:GAATCCTGCATGAGTTGAGGA
(CT)9 60 °C 2 186–192 0.48 0.30 0.35
33 BrPe3014 F:CGGAAGCGTGCTCATAAAGT
R:AAGCCTGTGAGGTTGATTCG
(AGA)5 60 °C 2 218–220 0.48 0.30 0.35
34 BrPe0007 F:AAAGCCCAGATGAAGTGAA
R:GGCTCCAATCAGAAGTGT
(AG)9 55 °C 2 177–179 0.40 0.50 0.31
35 BrPe0027 F:TCCAATCTTCTCAACC
R:CAAACTAGTAAACCCC
(TA)6 46 °C 3 97–101 0.35 0.20 0.30
36 BrPe3027 F:CCAAAATGCCCAAAATGTCT
R:GTCCGTGAGGAGATGTCGAT
(GGT)4 60 °C 3 178–202 0.35 0.40 0.30
37 BrPe0019 F:AAAGAGAAGGATGGATG
R:AAAAAGGACGAGGAAGA
(TC)7 55 °C 2 210–214 0.36 0.14 0.28
38 BrPe0044 F:GGACGCTAAGAGACCCATTG
R:TAAAAGCCCCACTTGCAATC
(TA)6 60 °C 2 217–219 0.33 0.38 0.26
39 BrPe0016 F:TGGTTGGTGGGTCTTGT
R:CTCTTTCCTCTCTCTCTCTCT
(AG)7 55 °C 2 277–279 0.21 0.22 0.18
40 BrPe0045 F:CGCTTCCACTTTACCAGCTC
R:GACCAACAACAGGCACAATG
(GT)8 60 °C 2 183–185 0.21 0.22 0.18
41 BrPe0011 F:GTTCTACTCCCTCATT
R:CTTCTTAACATCCCCA
(CT)8 53 °C 2 74–80 0.19 0.20 0.16
42 BrPe0017 F:TTGTCTCTCGGTTCTCT
R:CAAACACAAAACCCCC
(AG)7 55 °C 2 86–90 0.19 0.00 0.16
  AVERAGE     3.26   0.55 0.35 0.45
  1. F: forward primer; R: reverse primer; Ta: annealing temperature; Ho: observed heterozygosity; He: expected heterozygosity; PIC: polymorphic information content