Skip to main content

Table 2 Top 30 significantly DE miRNAs and their predicted target genes from microarray analysis in PMECs at 24 hpc with E. coli compared with unchallenged controls

From: MicroRNA expression profiling of porcine mammary epithelial cells after challenge with Escherichia coli in vitro

24 hpc with E. coli   
Upregulated miRNA Sequence (5′ - > 3′) Downregulated target genes
 miR-505 CGUCAACACUUGCUGGUUUCCU ABCA7, DDX18, DDX52, EIF4E, GRPEL1, LARP4, MSL1, PLEKHH1, SDC1, SERTAD1, SOCS4, TATDN2, WDR3, YTHDF2, ZBED4
 miR-29a UAGCACCAUUUGAAAUCGGUU CDC6, CYP26A1, DNAJA1, EML5, RNF2, TIMM44
 miR-101 UACAGUACUGUGAUAACUGAAG CHD7, EML5, HELLS, LARS, MID1, RBM12
 miR-24-star GUGCCUACUGAGCUGAUAUCAGU USP46
 miR-289 UAAAUAUUUAAGUGGAGCCUGCGACU KIAA1430, RNF2, TMCC3
 miR-125-star ACGGGUUAGGUUCUUGGGAGC GIT2, LARS, MSL1, PAFAH1B1, RBM12, SDC1, TMEM79, UBE2R2, ULK3, USP46
 miR-484 UCAGGCUCAGUCCCCUCCCGAU FGFR3
 miR-22-star AGUUCUUCAGUGGCAAGCUUUA ARGLU1
 miR-660 UACCCAUUGCAUAUCGGAGCUG ARMC8, BCLAF1, CAMKK2, CPT1A, DDX42, MSL1, NOL6, NRARP, PLEKHH1, PPP1R8, PPP6C, PSMD12, PSMF1, PYGO2, RRP12, SDC1, TRIM27, ZFX, ZNF280D
 miR-B6 AAGUGCCCGACGCGGGGAACGUG ENC1
 miR-363 AAUUGCACGGUAUCCAUCUGUA ABCA7, ADPRH, ATXN1, CAMKK2, DGCR8, FAM53C, GABPB1, GATAD2A, HERPUD2, PAFAH1B1, PLEKHH1, POP4, PPRC1, RBM15, S1PR2, SYK, TATDN2, TFAP2C, TRIM35, TXLNA
 miR-128 UCACAGUGAACCGGUCUCUUUU ADPRH, AQP3, GABPB1, KCNJ14, NDNL2, PLEKHH1, RRP12, SDC1, SNX6, TCEB3, UBE2R2, ULK3, ZFAND2A, ZFX, ZNF764
 miR-10a UACCCUGUAGAUCCGAAUUUGUG ADPRHL2, EML5, FARSA, FEN1, IQCC, KLHL18, LMNB2, MFSD9, SFN, SLC16A3, SLC39A6, TATDN2, TLE1, TMCC3, TUBB2B, TXLNA, UBAP2L, ZNF367
 miR-92b AAUUGCACUAGUCCCGGCCUGC CPT1A, GPRC5A, HEXIM1, LIN37, PHF23, PKP1, ULK3, YWHAG
 miR-92b UAUUGCACUCGUCCCGGCCUCC EML5
Downregulated miRNA Sequence (5′ - > 3′) Upregulated target genes
 miR-371 ACUCAAAAAAUGGCGGCACUUU SGSM1
 miR-4423-3p AUAGGCACCAAAAAGCAACAA RASAL2
 miR5019 UGUUGGGAAAGAAAAACUCUU RASAL2
 miR-3128 UCUGGCAAGUAAAAAACUCUCAU SLC2A12
 miR5021 UGAGAAGAAGAAGAAGAAAA CIRBP
 miR-M9-3p AAACUCCGAGGGCAGGAAAAAG ARHGAP12, ARHGAP28, BIRC3, CEP68, FCHSD2, GRK5, ISG15, LPIN1, MDM4, PCDH7, PDLIM5, SLC2A12, TCTN2, YPEL2
 miR3949 UGAUGUUGAGGCAAAAAUGUAG CCDC152, RBM39, RFX1,
 miR-B8-5p CGCGGGCAAAAAAUCCAAUGGC BIRC3, MAP3K8, PLXND1, RNF19B
 miR-2326 CCCCCCUUCCUCUGGAAAAA ARHGAP28, CEP68, CHI3L1, CXCL2, FNBP1, LPIN1, PCDH7, PLXND1, PPAP2B, RFFL, RHOQ, SCUBE3, SLC4A7, TPM2
 miR-5100 UCGAAUCCCAGCGGUGCCUCU OBFC1
 miR-259-star CCACCGAUUUGGCAUGGGAUUGAC SGSM1
 miR-2779 AUAUCCGGCUCGAAGGACCA CLDN1, PLXND1
 miR-4592 CCAGCGGCGGUGCCGUGAUGGCGA CLDN1, CEP68, CXCL2, ITGB8, MDM4, RHOQ
 miR-202 AGAGGCAUAGAGCAUGGGAAAA ARHGAP28, BIRC3, CHL1, GLI3, LIFR, MAP3K8, P2RX4, PLN, RASAL2, RFFL, RMND5A, RNF19B, SGSM1, TEP1, TNFAIP3, TPM2, VPS37C
 miR-3277 UGGGCAUGUUUCUGAAAUUCGAU ARHGAP28, IFNAR2, IL1A, PPARG
  1. MiRNAs with p < 0.05 and fold change >1.5 or < −1.5 are listed and sorted by fold change in descending order. TargetScan-predicted miRNA-mRNA pairs showing negative correlation in expression profile and energy-value of at least −25 kcal/mol