Skip to main content

Table 3 Primers

From: Lack of 14-3-3 proteins in Saccharomyces cerevisiae results in cell-to-cell heterogeneity in the expression of Pho4-regulated genes SPL2 and PHO84

Primer Sequence (5′- 3′)
Bmh1-kanMX- Fw GCAAGTGAGAAGAAAAAGCAAGTTAAAGATAAACTAAAGATAAAACAGCTGAAGCTTCGTACGC
Bmh1-kanMX-Rv AGATTTATCAGAATACTTACTTTGGTGCTTCACCTTCGGCGGCAGCGCATAGGCCACTAGTGGATCTG
Bmh2-kanMX-Fw GAAAAATTATCAAATCAACAAAAAGTACCCGTTACAACAAAAAAACAGCTGAAGCTTCGTACGC
Bmh2-kanMX-Rv GCAAGAAAACTGGAGTGGTAAATCTTCATTTCCCCTTGTATTTCTGCATAGGCCACTAGTGGATCTG
PHO84-qPCR-Fw ACAACCTTG TTGATCCCAG AA
PHO84-qPCR-Rv TGCTTCATGTTGAAGTTGAGATG
SPL2-qPCR-Fw CCGAGGAGATCGCTTCTCTA
SPL2-qPCR-Rv ACGCTGCGCTCTACTTGAAT
ACT1-qPCR-Fw CTGCCGGTATTGACCAAACT
ACT1-qPCR-Rv CGGTGATTTCCTTTTGCATT
PHO80-kanMX-Fw AAGCTATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCCAGCTGAAGCTTCGTACGC
PHO80-kanMX-Rv TTTTGCTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACCGCGGCCGCATAGGCCAC
SPL2-GFP-Fw2 ATTGACGAAGACATATTCGAAGATTCGTCTGACGAAGAACAATCACGTACGCTGCAGGTCGAC
SPL2-GFP-Rv GTCAATGCATATGTAACAGTACAGAGGTAGAAGGTATGTGTATCGATGAATTCGAGCTCG
P-pho84-Fw AAA GAGCTC AATCAGTATT ACGCACGTTGGT
P-pho84-Rv AAA ACTAGT CATTTGGATTGTATTCGTGGAGT
T-pho84-Fw AAA GGATCC TAAAAGCCT CAAAGATGCA CTAA
T-pho84-Rv AAA GAATTC CTGTCCCACAGGTGCCATTG
P-cyc1-Fw AAA GAGCTC GTTCATTTGG CGAGCGTTGG
P-cyc1-Rv AAA ACTAGT CATTATTAATTTAGTGTGTGTATTTG
T-cyc1-Fw AAA GGATCC TAA ACAGGCCCCT TTTCCTTTGTC
T-cyc1-Rv AAA GAATTC ATGTTACATGCGTACACGCGT
P-spl2-Fw AAA GAGCTC TTTACACTGGGATATTACAAGAC C
P-spl2-Rv2 AAA ACTAGT CATCTGTCCAATTTGCCCCTG
T-spl2-Fw AAA GGATCC TGATTGCATCTCTTAATCGTTACAC
T-spl2-Rv AAA GAATTC AAAGGGCCAGCGAATGCGCG
GFP-Fw AAA ACTAGT ATGTCTAAAGGTGAAGAATTATTCA
GFP-Rv AAA GGATCC TTTGTACAATTCATCCATACCATA
PHO4-Fw GG GAATTC GTCTCTGTCTAATGCGGTCAC
PHO4-Rv GG GGATCC GTTCTCTCAAATCTTCCAACTGATC