Skip to main content

Table 1 Primer names, sequences, melting temperatures (Tm), lengths, and PCR fragment sizes

From: Insights into teleost sex determination from the Seriola dorsalis genome assembly

Primer Name Sequence Tm (°C) Length (bp) Fragment Size (without/with deletion)
SdorDel01-F AATTCATCCAAACCCAGCAG 59.9 20 452 bp/391 bp
SdorDel01-R GGTCTTGTCAACTGCGATCA 59.8 20
SdorDel02-F TGACAACAAGGCAACAGGAG 59.9 20 282 bp/221 bp
SdorDel02-R TTGGCCTTTCTTTTGACCAC 60.1 20