Table 1 Primer names, sequences, melting temperatures (Tm), lengths, and PCR fragment sizes
From: Insights into teleost sex determination from the Seriola dorsalis genome assembly
Primer Name | Sequence | Tm (°C) | Length (bp) | Fragment Size (without/with deletion) |
|---|---|---|---|---|
SdorDel01-F | AATTCATCCAAACCCAGCAG | 59.9 | 20 | 452 bp/391 bp |
SdorDel01-R | GGTCTTGTCAACTGCGATCA | 59.8 | 20 | |
SdorDel02-F | TGACAACAAGGCAACAGGAG | 59.9 | 20 | 282 bp/221 bp |
SdorDel02-R | TTGGCCTTTCTTTTGACCAC | 60.1 | 20 |