Skip to main content

Table 1 The primers used for qRT-PCR verification

From: Transcriptomic analysis between self- and cross-pollinated pistils of tea plants (Camellia sinensis)

ID Forward (5′-3′) Reverse (5′-3′)
CSA006398 GGCGTATCCAACAATCTTATCG CCAAACCCAATCATCATCCA
CSA005891 GAACGTGTGTTGGTCATTGAT CATAAATTGTCTACTGGCGAG
CSA028406 GAGATTCAGTTGTCGCTTTG AGAGCCACCATTTCATTAGC
CSA024717 CCACTGCCACTTGTCGTTGTT GAGTTTGCCACCGTGAATTCG
CSA002728 GTCGTTCCACTGGCTTCCTAC GGCAGTAGTTGTTCATAGAGA
CSA026098 GGCTCCCTCTTTCTTTATATG CCACCATCAATTTCTCCCTTG
CSA024379 TCCCATCATTAGCCTGCCAAC ATCCCATCTCAGCCCATAAC
GAPDH TTGGCATCGTTGAGGGTCT CAGTGGGAACACGGAAAGC