Skip to main content

Table 4 Genes from which the primer sequences of candidate reference genes were derived, sequences of the primers and amplification efficiencies

From: The dehydration stress of couch grass is associated with its lipid metabolism, the induction of transporters and the re-programming of development coordinated by ABA

IDa AGIb Namec Primer sequence Efficiency (%)d
Contig1390_3_s_at AT5G09810.1 ACT_F tcactcagcactttccaacagatgt 105
ACT_R gactagatgataacagcagtggagc
Contig2580_3_s_at AT1G69410.1 IF5A_F tttgggacccttgtgtttcctatgg 95
IF5A_R tttctggcatacagtttgcaccgtc
Contig1008_x_at AT5G14670.1 ADP-RF_F tagttctctcgggatgtcgggggtc 91
ADP-RF_R gacaaaaatgagaccctgggtgttctga
Contig21863_at   HSP90_R ggacgctgtttattggctacgacga 103
HSP90_F tccatacacacagtcgggacgtatc
Contig306_s_at AT5G45350.2 SIGPRP_F taccctggctcatctggtcacagtg 90
SIGPRP_R agagatcttgtgtgctccgtaagcg
Contig149_at AT1G13440.1 GAPDH_F gggttcccactgtggatgtgtcagt 91
GAPDH_R ttccctcggaagcagccttgatagc
  1. aAffymetrix 22 K Barley1 GeneChip Genome Array probe set ID
  2. bA. thaliana locus identifier corresponding to individual IDs
  3. cF forward, R reverse, ACT Actin, IF5A Translation elongation factor 5A, ADP-RF ADP-ribosylation factor, HSP90 cytosolic heat shock protein 90, SIGPRP similar to GPRP (proteins rich in glycine and proline), GAPDH glyceraldehyde-3-phosphate dehydrogenase
  4. dAmplification efficiency