Skip to main content

Table 4 List of miRNA-mRNA pairs and their expressions in lambs and adults

From: Integrated miRNA-mRNA analysis reveals regulatory pathways underlying the curly fleece trait in Chinese tan sheep

miRNAs Target Genes
Name Sequence Fold Change (Lamb vs. Adult) Name Expression in SSH
novel_138 UGGAUAACGCGUCUGACU 3.2613 MYH10 L > A
novel_138 UGGAUAACGCGUCUGACU 3.2613 STXBP2 L < A
oar-miR-433-3p AUCAUGAUGGGCUCCUCGGUGU 1.2821 STXBP2 L < A
oar-miR-433-3p AUCAUGAUGGGCUCCUCGGUGU 1.2821 TCHH L > A
oar-miR-541-5p AAAGGAUUCUGCUGUCGGUCCCACU 2.1341 MYH10 L > A
oar-miR-541-5p AAAGGAUUCUGCUGUCGGUCCCACU 2.1341 TCHH L > A
oar-miR-1185-5p AGAGGAUACCCUUUGUAUGUUC 2.5882 SLC25A20 L > A
oar-miR-150 UCUCCCAACCCUUGUACCAGUG −2.2216 KRT14 L < A
oar-miR-3959-3p UGUAUGUCAACUGAUCCACAGU 2.0561 TBRG4 L < A
oar-miR-376b-3p AUCAUAGAGGAAAAUCCAUGU 1.819 TBRG4 L < A
oar-miR-495-5p AGAAGUCGCCCAUGUUCUUUUCG 1.7341 STXBP2 L < A
oar-miR-487a-3p AUCAUACAGGGACAUCCAGUUU 1.6256 SLC25A20 L > A
oar-miR-376e-5p GGUGGAUAUUCCUUCUAUGUUU 1.4007 MYH10 L > A
oar-miR-376e-5p GGUGGAUAUUCCUUCUAUGUUU 1.4007 TBRG4 L < A
oar-miR-432 UCUUGGAGUAGGUCAUUGGGUGG 1.31 KRT14 L < A
oar-miR-432 UCUUGGAGUAGGUCAUUGGGUGG 1.3112 TCHH L > A
oar-miR-432 UCUUGGAGUAGGUCAUUGGGUGG 1.3112 KRT83 L > A
oar-miR-432 UCUUGGAGUAGGUCAUUGGGUGG 1.3112 STXBP2 L < A
oar-miR-106a AAAAGUGCUUACAGUGCAGGU 1.0772 SLC25A20 L > A
oar-miR-539-3p AAUCAUACAAGGACAAUUUCUUU 1.0261 SLC25A20 L > A
oar-miR-29a UAGCACCAUCUGAAAUCGGUU −2.6593 COL3A1 L < A
oar-miR-29a UAGCACCAUCUGAAAUCGGUU −2.6593 KRT14 L < A
oar-miR-29a UAGCACCAUCUGAAAUCGGUU −2.6593 TBRG4 L < A
oar-miR-148a UCAGUGCACUACAGAACUUUGU −1.7737 KRT14 L < A
oar-miR-148a UCAGUGCACUACAGAACUUUGU −1.7737 LYPD3 L < A
oar-miR-29b UAGCACCAUUUGAAAUCAGUGU −1.7632 COL3A1 L < A
oar-miR-29b UAGCACCAUUUGAAAUCAGUGU −1.7632 KRT14 L < A
oar-miR-29b UAGCACCAUUUGAAAUCAGUGU −1.7632 TBRG4 L < A
oar-miR-200c UAAUACUGCCGGGUAAUGAUGG −1.3461 STXBP2 L < A
oar-let-7a UGAGGUAGUAGGUUGUAUAGUU −1.2617 COL3A1 L < A
oar-let-7b UGAGGUAGUAGGUUGUGUGGU −1.1796 COL3A1 L < A
oar-let-7c UGAGGUAGUAGGUUGUAUGGUU −1.0598 COL3A1 L < A
oar-miR-218a UUGUGCUUGAUCUAACCAUGU −1.1696 STXBP2 L < A
oar-miR-133 UUGGUCCCCUUCAACCAGCUGU −1.1537 STXBP2 L < A
oar-miR-125b UCCCUGAGACCCUAACUUGUG −1.4684 KRT71 L > A
oar-miR-191 CAACGGAAUCCCAAAAGCAGCU −1.0191 TBRG4 L < A