Skip to main content

Table 4 miRNA expression in the LS and CK groups

From: Identification and characterization of miRNAs in the gills of the mud crab (Scylla paramamosain) in response to a sudden drop in salinity

ID Sequence Read count log2Ratio (LS/CK) Up / down P_ value Q _ value Different expression
CK LS
novel_mir1 AAGAGAGCUAUCCGUCGACAGU 11,244,923 9,582,299 −0.12 down 0 0 No
miR-100-5p_1 AACCCGUAGAUCCGAACUUGU 5,794,803 6,054,139 0.18 up 0 0 No
miR-100-5p AACCCGUAGAUCCGAACUUGUG 2,939,724 2,764,103 0.03 up 1.68E-127 1.02E-128 No
miR-100 AACCCGUAGAUCCGAACUU 326,542 343,837 0.19 up 0 0 No
novel_mir2 AUAGGUAGCUCUGAGUCCAGAG 217,367 216,078 0.11 up 1.4E-133 9.19E-135 No
novel_mir3 UACUGGCCUGCUAAGUCCCAAG 105,094 113,448 0.23 up 2.12E-295 2.58E-296 No
novel_mir4 UCCCUGAGACCCUUUCUUGUGA 45,082 50,918 0.29 up 3.49E-215 2.97E-216 No
novel_mir8 AAAUAUCAGCUGGUAAAUUUGG 23,653 28,276 0.37 up 1.1E-190 7.78E-192 No
novel_mir5 CAAUGCCCUUGGAAAUCCCAAA 55,060 25,181 −1.01 down 0 0 Yes
miR-7a UGGAAGACUAGUGAUUUUGUUGUU 22,817 23,572 0.16 up 5.26E-34 2.49E-35 No
novel_mir7 AGAUGACUACACGGCUGUGAGA 67,340 20,469 −1.60 down 0 0 Yes
novel_mir6 UGACUAGAGAUUCACACUCAUCC 17,884 18,990 0.20 up 2.25E-41 1.2E-42 No
novel_mir29 UGAACACAGCUGGUGGUAUCU 14,482 18,625 0.48 up 5.76E-199 4.45E-200 No
miR-7a_1 UGGAAGACUAGUGAUUUUGUUGU 12,463 11,125 −0.05 down 0.010473726 0.00024088 No
novel_mir9 CUUACGACCGCCUAGCACGGUA 8913 8789 0.10 up 0.0000104 2.77E-07 No
miR-7_2 UGGAAGACUAGUGAUUUUGUU 14,450 8319 −0.68 down 7.7E-268 8.19E-269 No
novel_mir10 GUACCGAAGCUGCGGAUGCGU 4672 8016 0.89 up 4.01E-258 3.79E-259 No
miR-7 UGGAAGACUAGUGAUUUUGUUG 1157 6374 2.58 up 0 0 Yes
novel_mir11 UGAGAGUGAGAGAUAGAGAGGA 5282 5626 0.21 up 7.06E-14 2.86E-15 No
novel_mir46 UGAUACUCGGGUGCCUGUUC 1227 1642 0.54 up 4.03E-23 1.81E-24 No
novel_mir56 GGUGUAGCAUAAGUGGGA 1384 975 −0.39 down 7.45E-11 2.75E-12 No
novel_mir39 UCUCCUCUUCCACUUUCUCGUC 245 415 0.88 up 1.71E-14 7.28E-16 No
novel_mir42 GUACAUGAGUUUGGGGAGGAUG 412 410 0.11 up 0.279773023 0.00529043 No
novel_mir12 AGAGGAAGCACAGGAUGAAGCA 299 321 0.23 up 0.059704709 0.00123915 No
novel_mir16 GCACCGAAGCUUAGGGUUCAGA 31 247 3.11 up 3.65E-46 2.07E-47 Yes
novel_mir13 UGAGGGGAAUGUGUUGGCCAGU 211 205 0.07 up 0.600140943 0.01063922 No
novel_mir34 UCACAGCCGUGUAGUCAUCUUG 536 172 −1.52 down 9.21E-39 4.61E-40 Yes
novel_mir38 UAACGUUUCGUACAGAGUACUU 86 156 0.97 up 0.000000268 8.45E-09 No
novel_mir25 CCUAUCACCACUACCACUACUG 118 106 −0.04 down 0.839846761 0.01429315 No
novel_mir17 UGGUGGCUGGUCGAGCGAGGACU 62 72 0.33 up 0.184002039 0.00369166 No
novel_mir21 UGGAGGAUGGAAGGCCGUGUGU 74 54 −0.34 down 0.186548791 0.00369166 No
novel_mir27 GUCGAGGAGAGGUCAGUGCCA 28 50 0.95 up 0.004289186 0.00010138 No
novel_mir47 AUGAUGGCAGCGGUGACUCGA 0 43 6.54 up 4.94E-12 1.91E-13 Yes
novel_mir36 ACGGGUGGAUGGGUGGGUG 37 43 0.33 up 0.303079488 0.00560656 No
novel_mir50 CGGGAGAGUUAAUUAGCAGUGUU 65 41 −0.55 down 0.053070425 0.00112899 No
novel_mir22 UGAGGGUGACUGGCAGGUGU 0 32 6.12 up 0.000000002 6.82E-11 Yes
novel_mir26 AUGAUGGCAGCGGUGACUCGA 14 28 1.12 up 0.014920708 0.00033412 Yes
novel_mir40 UGGAAUGCAUGGCUACACUUCAGU 0 27 5.87 up 3.44E-08 1.12E-09 Yes
novel_mir53 GGGUUAGUCGGGUCCUAAG 14 27 1.06 up 0.021514563 0.00046942 Yes
novel_mir49 UUGGCUGAUCCAGUAAGUUGU 40 27 −0.45 down 0.2046118 0.00395709 No
novel_mir35 UGUAUUGGGCGUGUGUUGGCCA 0 23 5.64 up 0.000000354 1.08E-08 Yes
novel_mir18 UAUAAUGGCUAUUGGUAUUCU 0 14 4.92 up 0.0000862 0.00000222 Yes
novel_mir20 UGACGGCGCCGCCACUACUGCU 17 14 −0.16 down 0.75159718 0.0130523 No
novel_mir19 AUCCUUGGACCACAGCAGAUGC 0 12 4.70 up 0.000309356 0.00000774 Yes
novel_mir37 CGCAGAUCCAGAAUGUUCCUCA 37 12 −1.51 down 0.000684211 0.0000166 Yes
novel_mir41 CGUGGGCAGGUGUGGGUGGCU 16 12 −0.30 down 0.584887298 0.01058942 No
novel_mir45 GGCGUGGCAGGGGUUUCUCGGACA 37 0 −6.09 down 5.77E-10 2.04E-11 Yes
novel_mir24 UCACCACUCUUGUCUCUGCCGAA 24 0 −5.47 down 0.0000006 1.76E-08 Yes
novel_mir48 UUACCCUGAUAUUCCUUGCCUGU 23 0 −5.41 down 0.00000105 2.96E-08 Yes
novel_mir31 CUAAUUUGAGCCAUCUGUCAGU 21 0 −5.28 down 0.0000032 8.79E-08 Yes
  1. RNA sequencing was conducted as a random sampling process, in which each read was sampled independently and uniformly from every possible nucleotide in the sample [16]. Under this assumption, the number of reads of a single gene (or transcript isoform) follows a binomial distribution (and can be approximated by a Poisson distribution). Screening differentially expressed small RNAs [45] proposes a novel method based on the MA-plot, which is a statistical analysis tool having been widely used to detect and visualize the intensity-dependent ratio of microarray data [51]. ID: miRNA id; CK: reads count of sample CK; LS: reads count of sample LS; log2Ratio (LS/CK): Log2 of the difference multiple; Up / down: Up (down) regulated