Skip to main content

Table 2 Ten most abundant known carp miRNAs identified in black, white, and red Koi carp skin samples

From: Identification and characterization of skin color microRNAs in Koi carp (Cyprinus carpio L.) by Illumina sequencing

miRNA Sequence BS Count RS Count WS Count
ccr-miR-199-5p CCCAGTGTTCAGACTACCTGTTC 4,100,063 3,122,326 3,587,226
ccr-miR-199-3p ACAGTAGTCTGCACATTGGTT 1,730,490 1,389,612 1,653,539
ccr-let-7a TGAGGTAGTAGGTTGTATAGTT 1,297,246 1,133,283 1,272,622
ccr-miR-21 TAGCTTATCAGACTGGTGTTGGC 1,309,364 1,138,255 1,255,244
ccr-miR-26a TTCAAGTAATCCAGGATAGGCT 1,086,517 902,538 1,092,863
ccr-miR-99 AACCCGTAGATCCGATCTTGT 809,551 750,404 781,225
ccr-miR-100 AACCCGTAGATCCGAACTTGT 877,228 697,664 706,497
ccr-miR-125b TCCCTGAGACCCTAACTTGTGA 742,182 506,300 590,501
ccr-miR-22a AAGCTGCCAGCTGAAGAACTGT 529,973 402,752 535,663
ccr-miR-126-3p CTCGTACCGTGAGTAATAATGC 485,109 394,630 476,118