Skip to main content

Advertisement

Table 1 List of primers used in this study

From: A transcriptomic snapshot of early molecular communication between Pasteuria penetrans and Meloidogyne incognita

S. No. Transcript name Primer names Annotation Primer sequence (5′ - 3′) Product length (bp) Tm (°C) Purpose
1 TR11426 P1_F heat shock protein 20 GGAAGAGGAACACAATGGCA 112 60 qRT PCR
P1_R TGCCTCAAATTTCCCAGTCC
2 TR14120 P3_F phospholipase A2 ACATTTCTCCATGTCAGCAC 78 60 qRT PCR
P3_R CGTTGCACTGGAGGAATAAA
3 TR16177 P4_F aspartic protease CTCCCTATCCTCCACCTATCAA 104 60 qRT PCR
P4_R CACCAAAGCTGACGGTATCA
4 TR10194 P5_F Bm 3887 AAACCTGGCAGATCACAAC 106 60 qRT PCR
P5_R CTCTGCTGTACCACAAACAA
5 TR10010 P6_F fructose bis phosphate aldolase GACCACCAGATAGGAATACAAC 114 60 qRT PCR
P6_R GGCAATCTTCACCCAAGAA
6 TR31579 P7_F selenium binding protein ATATATGAAGGTGGCCCTTGTC 131 60 qRT PCR
P7_R GCAATTGAAGAACCGACTTCTG
7 TR14793 P8_F glucosyl transferase CCATTTGACCACTCGATTCA 107 60 qRT PCR
P8_R GCATATCGCTCCTCAAATCA
8 TR23171 P10_F venom Allergen like protein TTGGACGTTGCCCTAGATA 100 60 qRT PCR
P10_R CTACATGGCTCACCAACATT
9 TR35213 P11_F glycoside hydrolase GGTGATTCCACCAGCATATT 121 60 qRT PCR
P11_R CCAAATGGCCCAGTATCTT
10 TR40461 P12_F glutathione S transferase TAAGCCAGAAGAGCCGAAA 111 60 qRT PCR
P12_R GTGGATCAACTTCGAAAGACTG
11 TR11544 P13_F fatty acid and retinol binding protein CGAATTGACCGAAGATGACA 106 60 qRT PCR
P13_R TTCGCTCTTCTCCTTCAATG
12 TR26363 P14_F major sperm protein ATACGTCGCGGTCTACAA 134 60 qRT PCR
P14_R TTCCGCTTCCGTCCTATT
13 TR10990 P15_F ubiquitin CCTCGACTGTTCGTGTATTG 101 60 qRT PCR
P15_R GTCATCATCCAACTGACATCC
14 TR20164 P17_F tropomyosin CGGGCAACCTCATCATATT 108 60 qRT PCR
P17_R GAACCGCTCGTTACAAGAT
15 TR24005 P18_F serine protease GGGTCATTCGTGCCATTT 108 60 qRT PCR
P18_R TGGTAATACGACCGTCTACTC
16 18S rRNA (HE667742) 18SMiRT F TCAACGTGCTTGTCCTACCCTGAA 155 60 qRT PCR
18SMiRT R TGTGTACAAAGGGCAGGGACGTAA
17 GFP (HF675000) gfp F AGCGGCACGACTTCTTCA 750 60 PCR
gfp R GTGTGGACAGGTAATGGTTGT
18 TR10010 FBP_F fructose bis phosphate aldolase GCGTCTTCACCTGCATACTT 402 62 PCR
FBP_R TAAGGCATTGGCAGACCATC
19 TR14793 GTfr_F glucosyl transferase AGGAATTGCTATTGAGCAGGATA 400 62 PCR
GTfr_R GACTGGGACACCAGCATATAAA
20 TR26363 Msp_F major sperm protein CTTCGCGCTCTTCACTCTT 399 62 PCR
Msp_R CTTCCGCTTCCGTCCTATTC
21 TR16177 Asp_F aspartic protease CCAGCATCAGATCACGAAGAT 448 62 PCR
Asp_R GGTGGAGGATAGGGAGCTATTA
22 TR10990 Ubq_F ubiquitin GTTGTCCTAGAGCCAACACTC 400 62 PCR
Ubq_R CGCAATAATGACGATTCGTATGC