Skip to main content

Table 6 Computationally predicted transcript targets of miR399 species identified from sRNA deep sequencing in N. benthamiana

From: Identification and characterisation of microRNAs and their target genes in phosphate-starved Nicotiana benthamiana by small RNA deep sequencing and 5’RACE analysis

Sequencing IDa (miRNA name/number) Nearest homologue miRNA Sequence miRNA Length Expectb Target Transcript, Target Accessionc Cleavage validation by 5’ RACE
B29_6_545_21_6_mir399 (miR399–1) Ptc-miR399d UGCCAAAGAAGAUUUGCCCCG 21 2 Inorganic phosphate transporter 1–4 (PHT1;4) (probable)
Nbv5.1tr6377121
Yes
M00266_miR399 (miR399–3) osa-miR399j UGCCAAAGGAGAGUUGCCCUA 2
B465_1_1169_21_2_mir399 (miR399–5) Ath-miR399b UGCCAAAGGAGAGUUGCCCUG 2
B1376_1_8_21_2_mir399 (miR399–4) osa-miR399i UGCCAAAGGAGAGCUGCCCUG 3
B947_1_816_21_1_NA (miR399–2) Ptc-miR399f/g UGCCAAAGGAGAAUUGUCCUG 3.5
B947_1_816_21_1_NA (miR399–2) Ptc-miR399f/g UGCCAAAGGAGAAUUGUCCUG 21 2 Pattern formation protein: EMB30 (probable)
Nbv5.1tr6253408
No
M00266_miR399 (miR399–3) osa-miR399j UGCCAAAGGAGAGUUGCCCUA 3.5
B465_1_1169_21_2_mir399 (miR399–5) Ath-miR399b UGCCAAAGGAGAGUUGCCCUG 3.5
B29_6_545_21_6_mir399 (miR399–1) Ptc-miR399d UGCCAAAGAAGAUUUGCCCCG 4.5
B1376_1_8_21_2_mir399 (miR399–4) osa-miR399i UGCCAAAGGAGAGCUGCCCUG 4.5
B29_6_545_21_6_mir399 (miR399–1) Ptc-miR399d UGCCAAAGAAGAUUUGCCCCG 21 2.5 Probable UBIQUITIN-CONJUGATING ENZYME E2 24 (probable)
Nbv5.1tr6424601d
Yes (two sites)
3
3
2
B947_1_816_21_1_NA (miR399–2) Ptc-miR399f/g UGCCAAAGGAGAAUUGUCCUG 21 5
2
3.5
1.5
M00266_miR399 (miR399–3) osa-miR399j UGCCAAAGGAGAGUUGCCCUA 21 4.5
3
3
1
B1376_1_8_21_2_mir399 (miR399–4) osa-miR399i UGCCAAAGGAGAGCUGCCCUG 21
4
4
2
B465_1_1169_21_2_mir399
(miR399–5)
Ath-miR399b UGCCAAAGGAGAGUUGCCCUG 21 4.5
3
3
1
  1. amiRNA ID from Nicotiana benthamiana small RNA sequencing
  2. bpsRNA Target Analysis Expectation score ranges from 1 to 5, with a lower value indicating a better miRNA–target match
  3. cTarget Accession ID from Nicotiana benthamiana transcriptome v.5.1 (http://benthgenome.qut.edu.au/)
  4. dAll identified miR399 species in the table have three or four predicted binding sites in the Nbv5.1tr6424601 transcript