Skip to main content

Table 2 Novel milRNAs identified in T. rubrum

From: Integrated microRNA and mRNA analysis in the pathogenic filamentous fungus Trichophyton rubrum

MilRNA Sequence(5′-3′) Length (nt) Length of precursors (nt) MFE (kcal mol−1) Total reads
Conidia Mycelia
Tru-novel-miRNA-1 UACCAGACCAACUCCACACCCCU 23 171 −58.1 50 2
Tru-novel-miRNA-1* AGGGUUUGGUUUGGUUUGGUAU 22    6 0
Tru-novel-miRNA-2 ACAUGUGUCUGUAGUGUUUU 20 280 −74.9 13 22
Tru-novel-miRNA-2* UACGCCGCAGCAUUGAUAGAUG 22    1 0
Tru-novel-miRNA-3 UGAUCGGGAUUCCUCACGGUAU 22 208 −70.3 2 0
Tru-novel-miRNA-3* UUCGUAGAGGCAUCCUGGUC 20    1 0
Tru-novel-miRNA-4 UAGGCCUCCUGGCUCUCGAU 20 312 −140 4 0
Tru-novel-miRNA-4* CCAGACGGCCGGGCGGUAGAAG 22    1 0
Tru-novel-miRNA-5 CGACUGUGGCCAUGGAAGU 19 83 −32.2 465 209
Tru-novel-miRNA-6 UGCUUGAGAGUCACCGGAGAC 21 280 − 109.82 24 0
Tru-novel-miRNA-7 GAGCGCUUUCUUGAUCUUG 19 261 −100 0 17
Tru-novel-miRNA-8 AUCGGAGCGAUGCGAGACAUAGC 23 299 − 119.9 3 0
Tru-novel-miRNA-8* UCGAUGUUUCUCUGGGAUAC 20    1 0
Tru-novel-miRNA-9 UGCUCCUGCUCCUGCUCGGU 20 234 − 94.2 2282 217
Tru-novel-miRNA-10 UGAGCCAAAAGAGCGAGCCCACA 23 134 −50.55 7032 1492
Tru-novel-miRNA-10* UGGGCUGGUCGCUUUGGUUGA 21    5 0
Tru-novel-miRNA-11 UGGCUUGAAAUUCGGGAACCAGC 23 216 −73.9 96 31
Tru-novel-miRNA-12 UGGUGAUUGGGCUGGAUAGAC 21 282 −98.2 3 0