Skip to main content

Table 2 PCR primers used in this study

From: Exploring the differential mechanisms of carotenoid biosynthesis in the yellow peel and red flesh of papaya

Primer Sequence(5′–3′)
PSY1-F TGATGACTGAGGCTTATGACC
PSY1-R CCACCTATCTAAAGCTGTTGG
LCYB1-F ACTTGCTAGACTGCCTTGAC
LCYB1-R ACAGTGGCCTGAATCGTAAC
LCYB2-F CTATGCAAGAGACCCAACAAG
LCYB2-R GAGCTCCTTCCTTGAGATGTTC
LCYE-F GGCTCCAAAGTATGCTTCAGT
LCYE-R CCAGTCAGGTAGGTGGAAGAAAG
CHYB-F CTCTCCGCCGCCATTACC
CHYB-R TCCTCCAACACGAAGCAGAC
Actin-F CACCGAGGCTCCACTTAACC
Actin-R ACCAGAGTCCAGCACAATACC