Skip to main content

Table 1 Characteristics of predicted miRNA-like loci

From: In silico analysis of fungal small RNA accumulation reveals putative plant mRNA targets in the symbiosis between an arbuscular mycorrhizal fungus and its host plant

Genomic position Name Length Reads Strand Mature miRNA-like Mature miRNA-like length (nt) Up-regulation
scaffold_28:345427–345,528 Locus_338 102 37,395 UAAACACGAACUGUCCUAGU 20 No
scaffold_28:346121–346,253 Locus_339 133 2778 UAAAUACCGCGUGACCUAGA 20 No
scaffold_28:347535–347,650 Locus_340 116 74,526 UUAAAUAGAUGUUGAACUUGGUG 23 No
scaffold_28:349765–349,990 Locus_341 226 3636 UUUAAAGAGUAGGUGUCCUGAUC 23 RM
scaffold_28:350996–351,184 Locus_342 189 9875 UAAACACUGCUGUCCUAGUGG 21 RM
scaffold_28:351831–351,938 Locus_343 108 7174 UUAAAUGGGGGGUGUACUG 19 No
scaffold_28:353658–353,769 Locus_345 112 62,117 AAUUAAAGUGUGGCUGUCUUGGUG 24 No
scaffold_81:287993–288,405 Locus_818 413 17,160 + UGAGAGAUCUUUACUUGCAG 20 No
scaffold_81:370577–371,186 Locus_828 610 2143 CGAGGAUCGAGAGCUUGCACGUCA 24 RM
scaffold_245:162243–162,808 Locus_1596 566 196 UAACAGAAGUUGUUGGAUU 19 No