Skip to main content

Table 8 SNP verified by Sanger sequencing

From: Novel breeding approach for Japanese flounder using atmosphere and room temperature plasma mutagenesis tool

Gene Locus Primers 5′-3′ Size (bp) SNP type Detected in ARTP treated sample Detected in control
tp53 9,685,724 F: TGAAGAGCATAGCCAGGAG 228 A > T m8 /
R: ACCCTGATTCTTTAGGCCT
9,704,973 F: TCAGGTATGGCTTCCTCAC 236 A > G m5, m6, m8 /
R: AAACAAGACTTACTCGGGAG
9,705,000 F: TCACTCAGGGGAACATGT 192 T > A m5, m6, m7, m8 /
R: TCAGGATGGTGAGGATCTG
9,705,895 F: TTCCTGTGAGTAATGATGCAGT 226 T > C m5, m6, m7, m8 /
R: ACATTTGGAATTGATTGCAAAGT
9,712,498 F: CCCATTTGTTCAGAACCGC 164 G > A m5, m6, m7, m8 /
R: TCCAGTGAGAACGATTGCC
mstn 6,396,324 F: TCTCAGACCGTGATGTTTT 228 C > T m2, m4, m7 /
R: ATTCCTGGTGGTCTGTG