Skip to main content

Advertisement

Table 2 Primer sequences for RT PCR

From: Transcriptomic and proteomic analyses of genetic factors influencing adductor muscle coloration in QN Orange scallops

Gene name Primer sequence (5′ to 3′)
Apolipophorin F: CCACCTTTTGATGCTTTCGG
R: GAGGACGATGGAGAAGTTACC
CYP450 F:GCCGCAATCATTCTGAAGTTG
R: GAAATGCAGGTGTCAGCAAC
VPS F: ATCCAGAGCAGAAGGTTGTAAC
R: TTGTGAGTGTGACCAGAGATG
TIF F: CCAGAAAGATGTAGGGTTCCG
R: GTACCATCAAGTTCCTCTCCAG
BCOD1 F: GAGGGCGTAAAAGATGAGGTAC
R: AGGTGCTTGAAGTTGTCCTG
BCOD2 F: AATGTTGCCGATCAGTACCC
R: GCTTCATCGTTTTGGGATCG
SCAR F: ATGGAGACCTGGCTATTTTGG
R: CAGTCAATGCCATAAAACCCG
MTTP F: CCAGAAAGATGTAGGGTTCCG
R: GTACCATCAAGTTCCTCTCCAG
ApoA F: ACACAGACCCAGGAAATGAAG
R: TGTCCACATTCTCCTTGATCG
ApoB F: CTTACCTGAACGTGACCTCG
R: CTGAAAGTACATCTCCCTGCTC
RAB11A F: TGGCTGGACGAGTTAAAAGAG
R: TCAGGTCAGTTTTGTTCCCG
Tyrosinase F: CCCTCCCAAGACATCAACAG
R: CTCTGTAGATAGCACGCAGTTC
β-Actin F: TATGCCCTCCCTCACGCTAT
R: TTTCACTCTTTCCACCGGCTTT