Skip to main content

Table 8 Sequences of primers used in RT-qPCR

From: Development and evaluation of a milk protein transcript depletion method for differential transcriptome analysis in mammary gland tissue

Gene name Gene accession number Oligonucleotide name Oligonucleotide sequence (5′-3′)
PAEP NM_173929.3 LGB_F1 CAAGATCCCTGCGGTGTTCAAG
LGB_R1 ACTGTTCTCCATGCAGAAGAGC
LALBA NM_174378.2 LALBA_F2 CAGTTTGCCTGAATGGGTCT
LALBA_R3 GATCATCATCCAGGAACTTGTC
CSN1S2 NM_174528.2 CSN1S2_F2 CACCAGTGAGGAAAATTCAAAG
CSN1S2_R1 GCTGATAAACAGTCTTGAGATAC
CSN1S1 NM_181029.2 CSN1S1_F4 GTGCTGAGGAACGACTTCACAG
CSN1S1_R4A CAGTGTATTGTGTGCCTAGTGG
CSN3 NM_174294.2 CSN3_F5 GCCCACCTGAGATCAACACAG
CSN3_R5 AGGAGACGAGGAAGGAGCCAG
CSN2 XM_010806178.1 CSN2_F1 TGAGGAACAGCAGCAAACAG
CSN2_R1 ACAGGGGTTTGAGTAAGAGG
RPS15A NM_001037443.1 RPS15A_F1 CCGTGCTCCAAAGTCATCGTC
RPS15A_R1 TGAAACCAAACTGACGGGATG
CCL20 NM_174263.2 CCL20_F3 CAGCAAGTCAGAAGCAAGCAA
CCL20_R1 CCCACTTCTTCTTTGGATCTGC
IL6 NM_173923.2 IL6_F1 GGAGGAAAAGGACGGATGCT
IL6_R1 GGTCAGTGTTTGTGGCTGGA
PPP1CC NM_174581.2 PPP1CC_F1 TCGACAGCATCATCCAACG
PPP1CC_R1 CGGGAAACCACCGTACTCA