Skip to main content

Advertisement

Table 1 Primers used in RT-qPCR

From: Transcriptional analysis of renal dopamine-mediated Na+ homeostasis response to environmental salinity stress in Scatophagus argus

Gene Primer sequence (5′-3′) Amplicon size (bp)
CaMKIIα F: TCCCTGAACCTCTATGGCGA 111
R: ATGGGGGTGGTACACAGAGA  
dnm F: CACAAAGCGGGGAGAGGTAA 149
R: CTGGCTTTTGTGGCAGGTTG  
pkcβ F: TCGCACTGTGGTTCACATCA 175
R: GCAAGCAAGCAGCAGAGATG  
akt1 F: GCAGCACAGCATCAAGAGAG 207
R: TGCCAGACATGCAAAGAATGC  
dat F: GCTTATTGAAGCCATCGGCA 138
R: AACAGGAGGAAGCAGGGACT  
lrrk2 F: AACCTCTGGTGCTCGGAAAC 171
R: TACAGACTACGGCATCGCTC  
ace F: CATCCACTATGCTCCCTGCC 168
R: CGCAGCAATATTTCCAGCCC  
apn F: TTGGACAGGGCTATGGTTCC 82
R: TCCCCTGTTTTGATGAGCCA  
pink1 F: CGGCGAACATTTCCCTCTGT 193
R: TCCACAGAAAAGCGGAGCAC  
nka α1 F: AGCTGAAAGACATGACCGCA 183
R: TGTCAGCCTTCTTCAGAGCG  
β-actin F: CTGTGCTGTCCCTGTATG 151
R: TAGTCTGTGAGGTCACGG  
  1. (CaMKIIα calcium/calmodulin-dependent protein kinase II alpha, dnm dynamin, pkcβ protein kinase C beta, akt1 RAC-alpha serine/threonine-protein kinase, dat dopamine transporter, lrrk2 leucine-rich repeat kinase 2, ace angiotensin-converting enzyme, apn aminopeptidase N, pink1 PTEN-induced putative kinase 1, nkaα1 Na+/K+-ATPase subunit alpha 1, F forward, R reverse)